[Home] | [Total List]

[192121_at] sodium/phosphate trasnsprter

Description T19D12.10 /REP_DB=WormBase Gene ID /WP=CE18263 /TR=O76838 /GB=AAC24430.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=sodium-phosphate trasnsprter
Cluster 6grp_total > 65      4grp_total > 08      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/192121_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 69
1 2 3 4 range
A 2
(-3)
A
4.5
(-1.5)
A
6.2
(-0.5)
A
12.1
(3)
A
10
B 2.7
(-3)
A
7.2
(-2.6)
A
14.6
(-2)
A
71.2
(3)
A
69
C 3.2
(-3)
A
6.4
(-2.6)
A
25.6
(0)
A
47.8
(3)
A
45
avr 2.6
(-3)
6
(-2.5)
15.5
(-1.1)
43.7
(3)
41

Warning: fopen(./gnuplot/192121_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 28
1 2 3 4 5 6 range
A 10.7
(-2)
A
19
(0.7)
A
26.2
(3)
A
7.5
(-3)
A
8.8
(-2.6)
A
26.1
(3)
A
19
B 14.5
(-3)
A
19.3
(-1.2)
A
30.4
(3)
A
28.2
(2.2)
A
15.2
(-2.7)
A
22.7
(0.1)
A
16
C 2.5
(-3)
A
4.4
(-2.5)
A
2.3
(-3)
A
5.3
(-2.3)
A
2.4
(-3)
A
27.7
(3)
A
25
avr 9.2
(-2.9)
14.2
(-1.1)
19.6
(0.9)
13.7
(-1.2)
8.8
(-3)
25.5
(3)
17
No Scale

Warning: fopen(./gnuplot/192121_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 15
1 2 3 4 range
A 0.7
(-3)
A
1
(-1.4)
A
1.6
(1.9)
A
1.8
(3)
A
1
B 0.9
(-3)
A
1.8
(-2.6)
A
3.4
(-2)
A
15.2
(3)
A
14
C 1.1
(-3)
A
1.8
(-2.5)
A
8.9
(3)
A
8.1
(2.4)
A
8
avr 0.9
(-3)
1.5
(-2.5)
4.6
(-0)
8.4
(3)
8

Warning: fopen(./gnuplot/192121_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192121_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 9
1 2 3 4 5 6 range
A 2
(-2.9)
A
6.8
(3)
A
5.7
(1.7)
A
1.9
(-3)
A
2.7
(-2)
A
6.4
(2.5)
A
5
B 5
(-3)
A
6.4
(-0.6)
A
7.4
(1.1)
A
7.5
(1.3)
A
6.2
(-0.9)
A
8.5
(3)
A
4
C 0.9
(-2.8)
A
1.3
(-2.5)
A
0.6
(-3)
A
1.1
(-2.7)
A
0.8
(-2.9)
A
9.3
(3)
A
9
avr 2.6
(-3)
4.8
(-0.6)
4.6
(-0.8)
3.5
(-2)
3.2
(-2.3)
8.1
(3)
6
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192121_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4411
Sequence Type Exemplar sequence
Representative Public ID T19D12.10 NCBI
Target Description T19D12.10 /REP_DB=WormBase Gene ID /WP=CE18263 /TR=O76838 /GB=AAC24430.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=sodium-phosphate trasnsprter
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062953(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062953 NCBI Caenorhabditis elegans T19D12.10 (T19D12.10) mRNA, complete cds. 11/11 None
SNAP00000003087 ENSEMBL cdna:SNAP chromosome:CEL140:II:6655133:6656338:-1 11/11 None
GENEFINDER00000003091 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:6655133:6658755:-1 11/11 None
T19D12.10 ENSEMBL cdna:known chromosome:CEL140:II:6655133:6658755:-1 gene:T19D12.10 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:6655129-6658752(-) 100.0 100.0
Public Domain and Genome References
Gene Title sodium/phosphate trasnsprter
Ensembl T19D12.10
Entrez Gene 188611 Entrez gene
SwissProt O76838 EMBL-EBI
WormBase CE18263 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAC24430 Hypothetical protein T19D12.10 [Caenorhabditis elegans] ref|NP_495354.1| T19D12.10 [Caenorhabditis elegans] 0.0
blast AAC24431 Hypothetical protein T19D12.9 [Caenorhabditis elegans] ref|NP_495353.1| T19D12.9 [Caenorhabditis elegans] 1.0E-177
blast CAE56160 Hypothetical protein CBG23780 [Caenorhabditis briggsae] 1.0E-168
blast AAC24430 Hypothetical protein T19D12.10 [Caenorhabditis elegans] ref|NP_495354.1| T19D12.10 [Caenorhabditis elegans] 1.0E-152
Protein Domains
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_495354.1 12 20-42,66-88,95-117,122-144,156-178,188-207,248-270,285-307,320-339,344-365,378-400,410-432
T19D12.10 12 20-42,66-88,95-117,122-144,156-178,188-207,248-270,285-307,320-339,344-365,378-400,410-432
SNAP00000003087 7 15-37,77-99,114-136,149-168,173-194,207-229,239-261
GENEFINDER00000003091 12 20-42,66-88,95-117,122-144,156-178,188-207,248-270,285-307,320-339,344-365,378-400,410-432
Sequence
Target Sequence
>C. ELEGANS:192121_AT
tattggcagtttggtcatcggctcttgggggtaatatgtcactgatgactttaatgattt
atggaccaacatatctcaataaagtattacaacttgatgttaaagatacaggatttgcaa
atgcaattccttatattatggcaactgcagtgaaatttactgcaggtccattgtctgata
aactgacacgtattcctgatacatggaaaatgattttctttgctgcagtctctcaactag
gaatggcaatgggattctttgtaatggcattgactcgatccaagttcattgcacaaatcg
cctacactggagccattgttcttgccggtgttaacatgattggtgtagtgaagtgtgcac
aaatggtatcccgtcaatatacgcattttgtaatggcagtaaactctctaatttcatgga
ttgccattcttattcttccaatgattatcggagtattatgtccgaatcattcaccggaag
aatgggctgtattttatacttctggcggaatatgggttattattatgaatattccatttc
ccttcttggtaaca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TATTGGCAGTTTGGTCATCGGCTCT 129 667 758 Antisense
GGCTCTTGGGGGTAATATGTCACTG 261 539 777 Antisense
GAAATTTACTGCAGGTCCATTGTCT 270 363 909 Antisense
GATAAACTGACACGTATTCCTGATA 311 421 934 Antisense
TTTCTTTGCTGCAGTCTCTCAACTA 498 671 972 Antisense
GACTCGATCCAAGTTCATTGCACAA 136 375 1029 Antisense
GTGTGCACAAATGGTATCCCGTCAA 558 487 1110 Antisense
AACTCTCTAATTTCATGGATTGCCA 560 141 1159 Antisense
GGATTGCCATTCTTATTCTTCCAAT 164 509 1175 Antisense
GTATTATGTCCGAATCATTCACCGG 675 451 1210 Antisense
TATTCCATTTCCCTTCTTGGTAACA 505 661 1287 Antisense
Sequence Source Affymetrix Proprietary Database