[Home] | [Total List]

[191713_at] protein-tyrosine phosphatase

Description K09F6.3 /REP_DB=WormBase Gene ID /WP=CE12028 /TR=O16728 /GB=AAB66199.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=protein-tyrosine phosphatase
Cluster 6grp_total > 68      4grp_total > 0      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/191713_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 52
1 2 3 4 range
A 31.6
(3)
A
7
(-2.9)
A
6.4
(-3)
A
8
(-2.6)
A
25
B 9.7
(-2.9)
A
8.9
(-3)
A
40.9
(2.6)
A
43.3
(3)
A
34
C 10.1
(-2.4)
A
4.6
(-3)
A
29.3
(-0.1)
A
56.5
(3)
A
52
avr 17.1
(-0.9)
6.8
(-3)
25.5
(0.9)
35.9
(3)
29

Warning: fopen(./gnuplot/191713_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 72
1 2 3 4 5 6 range
A 5.1
(-2.5)
A
3.2
(-3)
A
10.6
(-1.2)
A
6.9
(-2.1)
A
5.2
(-2.5)
A
27.4
(3)
A
24
B 12.8
(-1.8)
A
6
(-2.6)
A
2.5
(-3)
A
3.8
(-2.9)
A
12.3
(-1.9)
A
55.1
(3)
A
53
C 12.4
(-2.3)
A
4.4
(-3)
A
6.2
(-2.8)
A
14.2
(-2.2)
A
17.4
(-1.9)
A
74.7
(3)
A
70
avr 10.1
(-2.3)
4.5
(-3)
6.4
(-2.8)
8.3
(-2.5)
11.6
(-2.1)
52.4
(3)
48
No Scale

Warning: fopen(./gnuplot/191713_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 10
1 2 3 4 range
A 11.5
(3)
A
1.5
(-2.8)
A
1.7
(-2.7)
A
1.2
(-3)
A
10
B 3.1
(-2.3)
A
2.2
(-3)
A
9.5
(3)
A
9.2
(2.8)
A
7
C 3.3
(-1.7)
A
1.3
(-3)
A
10.2
(3)
A
9.5
(2.5)
A
9
avr 6
(1.8)
1.7
(-3)
7.1
(3)
6.6
(2.4)
5

Warning: fopen(./gnuplot/191713_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191713_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 24
1 2 3 4 5 6 range
A 0.9
(-3)
A
1.1
(-2.8)
A
2.3
(-1.6)
A
1.7
(-2.2)
A
1.6
(-2.3)
A
6.7
(3)
A
6
B 4.5
(-1.8)
A
2
(-2.6)
A
0.6
(-3)
A
1
(-2.9)
A
5
(-1.7)
A
20.5
(3)
A
20
C 4.6
(-2.2)
A
1.3
(-3)
A
1.6
(-2.9)
A
2.8
(-2.6)
A
5.6
(-1.9)
A
25
(3)
A
24
avr 3.3
(-2.3)
1.5
(-3)
1.5
(-3)
1.8
(-2.9)
4.1
(-2)
17.4
(3)
16
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 191713_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5170
Sequence Type Exemplar sequence
Representative Public ID K09F6.3 NCBI
Target Description K09F6.3 /REP_DB=WormBase Gene ID /WP=CE12028 /TR=O16728 /GB=AAB66199.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=protein-tyrosine phosphatase
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_061820(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_061820 NCBI Caenorhabditis elegans K09F6.3 (K09F6.3) mRNA, complete cds. 11/11 None
K09F6.3 ENSEMBL cdna:known chromosome:CEL140:II:2256307:2261102:1 gene:K09F6.3 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000009214 8/11 Cross Hyb Matching Probes None
GENEFINDER00000009246 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:2259151-2261099(+) 92.34 100.0
Public Domain and Genome References
Gene Title protein-tyrosine phosphatase
Ensembl K09F6.3
Entrez Gene 173583 Entrez gene
SwissProt O16728 EMBL-EBI
WormBase CE31563 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6470 protein amino acid dephosphorylation inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4721 phosphoprotein phosphatase activity inferred from electronic annotation QuickGO AmiGO
4725 protein tyrosine phosphatase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB66199 Hypothetical protein K09F6.3 [Caenorhabditis elegans] ref|NP_494221.2| K09F6.3 [Caenorhabditis elegans] 0.0
blast AAB66194 Hypothetical protein K09F6.4 [Caenorhabditis elegans] ref|NP_494222.1| K09F6.4 [Caenorhabditis elegans] 1.0E-179
blast AAC68761 Hypothetical protein C40A11.5 [Caenorhabditis elegans] ref|NP_494193.1| C40A11.5 [Caenorhabditis elegans] 8.0E-45
Protein Domains
Database ID Description E-Value
Pfam IPR003125 EMBL-EBI Protein of unknown function WSN 3.6E-19
Pfam IPR000242 EMBL-EBI Tyrosine specific protein phosphatase 1.1E-67
Sequence
Target Sequence
>C. ELEGANS:191713_AT
atctcttgttgtgcactgctcgaatggaattggacgttctgcagcgtttgtttcgtggga
gctatgctatcactttgttccagtcaactttgaaatttgtgatttttcagtcgctgagtt
cgtctaccaaaagatgattcgtagtctggacacaacttccaccgtgaatctggatttctt
gtcattgcttaccgagctgagacattcaagacccagagccatccacacgccgatgcaatt
ggctttttccattatgatggtactggattttgtgatgaataattttccgaaaggagagat
ggaagccaagtatcaagagatcagaaagtcttatttgcatgctcgtcagatgatgcataa
ggatttggaatttgacggttctgacggtaaaactgttgatatcgctcttgacgaggatgg
tcatgggattccggagaaaaagggtaaaaagaagacgaacaagaaggctgcccaac


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATCTCTTGTTGTGCACTGCTCGAAT 359 31 744 Antisense
CTGCAGCGTTTGTTTCGTGGGAGCT 61 239 782 Antisense
GCTATGCTATCACTTTGTTCCAGTC 227 303 804 Antisense
TTCAGTCGCTGAGTTCGTCTACCAA 68 689 849 Antisense
GACACAACTTCCACCGTGAATCTGG 39 365 892 Antisense
GATTTCTTGTCATTGCTTACCGAGC 266 429 916 Antisense
TGAGACATTCAAGACCCAGAGCCAT 587 567 941 Antisense
CCATCCACACGCCGATGCAATTGGC 672 271 962 Antisense
GAAAGTCTTATTTGCATGCTCGTCA 292 361 1067 Antisense
AAAACTGTTGATATCGCTCTTGACG 678 129 1132 Antisense
AAGACGAACAAGAAGGCTGCCCAAC 704 153 1195 Antisense
Sequence Source Affymetrix Proprietary Database