[Home] | [Total List]

[191621_s_at] spectrin beta chain

Description R31.1 /REP_DB=WormBase Gene ID /WP=CE27773 /GEN=sma-1 /TR=O02425 /GB=CAB00130.2 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=spectrin beta chain
Cluster 6grp_highest_10_10 > 22      6grp_high1_10_10 > 02      4grp_highest_8_8 > 34      4grp_high_8_8 > 49      6grp_highest_nonorm > 41      6grp_total > 24      4grp_total > 62      6grp_highest_sub > De      6grp_cgc > 20      6grp_high1_sub > De      6grp_total_sub > Decrease      

Scale

Warning: fopen(./gnuplot/191621_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 378
1 2 3 4 range
A 605
(3)
P
462.1
(-0.5)
P
461.1
(-0.5)
P
357.3
(-3)
P
248
B 712.1
(3)
P
442.9
(-1.4)
P
517.9
(-0.2)
P
342.9
(-3)
P
369
C 658.8
(3)
P
522.2
(0.5)
P
634
(2.5)
P
334.6
(-3)
P
324
avr 658.6
(3)
475.7
(-0.5)
537.7
(0.7)
344.9
(-3)
314

Warning: fopen(./gnuplot/191621_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 795
1 2 3 4 5 6 range
A 853.2
(1.7)
P
956.3
(3)
P
493.6
(-3)
P
833.4
(1.4)
P
529.5
(-2.5)
P
622.9
(-1.3)
P
463
B 962.8
(3)
P
821.9
(1.6)
P
906.4
(2.4)
P
636.9
(-0.3)
P
361.5
(-3)
P
554.1
(-1.1)
P
601
C 1156.7
(3)
P
738.4
(-0.5)
P
902
(0.8)
P
637.6
(-1.4)
P
449.6
(-3)
P
499.4
(-2.6)
P
707
avr 990.9
(3)
838.9
(1.3)
767.3
(0.5)
702.6
(-0.2)
446.9
(-3)
558.8
(-1.8)
544
No Scale

Warning: fopen(./gnuplot/191621_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 175
1 2 3 4 range
A 220.3
(3)
P
100.3
(-1.3)
P
120.5
(-0.6)
P
52.3
(-3)
P
168
B 227.1
(3)
P
109.4
(-1.6)
P
120
(-1.2)
P
73.1
(-3)
P
154
C 218.1
(2.9)
P
150.1
(0.4)
P
221
(3)
P
56.4
(-3)
P
165
avr 221.8
(3)
119.9
(-0.8)
153.8
(0.5)
60.6
(-3)
161

Warning: fopen(./gnuplot/191621_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191621_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 321
1 2 3 4 5 6 range
A 157.3
(-1.7)
P
340.1
(3)
P
107.5
(-3)
P
211.4
(-0.3)
P
159.8
(-1.7)
P
151.7
(-1.9)
P
233
B 335
(3)
P
273.6
(1)
P
220.1
(-0.7)
P
168.7
(-2.3)
P
146.9
(-3)
P
206.6
(-1.1)
P
188
C 428.7
(3)
P
225.3
(-1.1)
P
229.6
(-1)
P
128.2
(-3)
P
145.5
(-2.7)
P
167.2
(-2.2)
P
301
avr 307
(3)
279.7
(2)
185.7
(-1.7)
169.4
(-2.3)
150.7
(-3)
175.2
(-2.1)
156
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 191621_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13798
Sequence Type Exemplar sequence
Representative Public ID R31.1 NCBI
Target Description R31.1 /REP_DB=WormBase Gene ID /WP=CE27773 /GEN=sma-1 /TR=O02425 /GB=CAB00130.2 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=spectrin beta chain
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_171544(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_171544 NCBI Caenorhabditis elegans SMAll family member (sma-1) (sma-1) mRNA, complete cds. 11/11 A 
SNAP00000005375 ENSEMBL cdna:SNAP chromosome:CEL140:V:11909537:11918729:1 11/11 None
GENEFINDER00000005381 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:11909727:11918729:1 11/11 None
R31.1 ENSEMBL cdna:known chromosome:CEL140:V:11903938:11919211:1 gene:R31.1 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:11904165-11918729(+) 100.0 100.0
Public Domain and Genome References
Gene Title spectrin beta chain
Gene Symbol sma-1
Ensembl R31.1
Entrez Gene 179629 Entrez gene
SwissProt O02425 EMBL-EBI
WormBase CE27773 Wormbase
Functional Annotations
Ortholog
ID Title Organism
DROSOPHILA_2:1637710_AT karst dm
DROSGENOME1:141351_AT karst dm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
18346 protein amino acid prenylation inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3779 actin binding inferred from electronic annotation QuickGO AmiGO
8318 protein prenyltransferase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB04608 Hypothetical protein R31.1 [Caenorhabditis elegans] emb|CAB00130.2| Hypothetical protein R31.1 [Caenorhabditis elegans] ref|NP_741632.1| SMAll family member (sma-1) [Caenorhabditis elegans] gb|AAC08577.1| beta chain spectrin homolog Sma1 [Caenorhabditis elegans] 0.0
blast CAE75346 Hypothetical protein CBG23326 [Caenorhabditis briggsae] 0.0
blast XP_396777 PREDICTED: similar to ENSANGP00000017034 [Apis mellifera] 0.0
Protein Domains
Database ID Description E-Value
scop a.4.5.Arginine repressor (ArgR), N-terminal DNA-binding domain All alpha proteins; DNA/RNA-binding 3-helical bundle; "Winged helix" DNA-binding domain; Arginine repressor (ArgR), N-terminal DNA-binding domain 0.239999994635582
Pfam IPR001452 EMBL-EBI SH3 3.4E-8
Pfam IPR001715 EMBL-EBI Calponin-like actin-binding 6.0E-32
Pfam IPR001715 EMBL-EBI Calponin-like actin-binding 1.6E-40
Pfam IPR001849 EMBL-EBI Pleckstrin-like 4.2E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 0.26
Pfam IPR002017 EMBL-EBI Spectrin repeat 4.1E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.7E-9
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.5E-10
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.6E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.8E-22
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.8E-5
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.4E-10
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.4E-22
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.0E-20
Pfam IPR002017 EMBL-EBI Spectrin repeat 6.6E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.8E-24
Pfam IPR002017 EMBL-EBI Spectrin repeat 6.4E-23
Pfam IPR002017 EMBL-EBI Spectrin repeat 5.6E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.2E-23
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.6E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.8E-17
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.9E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.6E-15
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.5E-20
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.4E-6
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.8E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.6E-20
Pfam IPR002017 EMBL-EBI Spectrin repeat 9.3E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 8.3E-17
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.3E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 7.8E-24
Pfam IPR002017 EMBL-EBI Spectrin repeat 5.4E-11
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.4E-21
Pfam IPR002017 EMBL-EBI Spectrin repeat 0.0014
Pfam IPR001849 EMBL-EBI Pleckstrin-like 4.2E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.5E-5
Pfam IPR002017 EMBL-EBI Spectrin repeat 6.6E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.8E-24
Pfam IPR002017 EMBL-EBI Spectrin repeat 6.4E-23
Pfam IPR002017 EMBL-EBI Spectrin repeat 5.6E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.2E-23
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.6E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.8E-17
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.9E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.6E-15
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.5E-20
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.4E-6
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.8E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.6E-20
Pfam IPR002017 EMBL-EBI Spectrin repeat 9.3E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 8.3E-17
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.3E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 7.8E-24
Pfam IPR002017 EMBL-EBI Spectrin repeat 5.4E-11
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.4E-21
Pfam IPR002017 EMBL-EBI Spectrin repeat 0.0014
Pfam IPR001849 EMBL-EBI Pleckstrin-like 4.2E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.1E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.8E-24
Pfam IPR002017 EMBL-EBI Spectrin repeat 6.4E-23
Pfam IPR002017 EMBL-EBI Spectrin repeat 5.6E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.2E-23
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.6E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.8E-17
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.9E-14
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.6E-15
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.5E-20
Pfam IPR002017 EMBL-EBI Spectrin repeat 3.4E-6
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.8E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.6E-20
Pfam IPR002017 EMBL-EBI Spectrin repeat 9.3E-19
Pfam IPR002017 EMBL-EBI Spectrin repeat 8.3E-17
Pfam IPR002017 EMBL-EBI Spectrin repeat 1.3E-16
Pfam IPR002017 EMBL-EBI Spectrin repeat 7.8E-24
Pfam IPR002017 EMBL-EBI Spectrin repeat 5.4E-11
Pfam IPR002017 EMBL-EBI Spectrin repeat 2.4E-21
Pfam IPR002017 EMBL-EBI Spectrin repeat 0.0014
Sequence
Target Sequence
>C. ELEGANS:191621_S_AT
ctcacaatgtcatcctcgtcgatgacggctaatgttatgccgacagttgtaactcgcaaa
attggagttgttcgaagagccagtcgacgacaatctgtttatgcagaaagcatctacgga
gaagtagaacaagcgattgctgaagcaaatcgtgtttctaccagtcgcccaaatggagat
catgctgaacttcgtcacacaattcaagttcatccaggaagctctggatatacggaaacc
ctcatgtacaaagaacacacatcatccaactatcaaccaatggaacgatctgtctcacca
agaaaccaacaaaatggcgaattcattacttgggtagagagcaatcaacaaaatcagccg
atgaatactccagacggcagatctacatctgccagtgttgtatc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CTCACAATGTCATCCTCGTCGATGA 553 227 11767 Antisense
GTTATGCCGACAGTTGTAACTCGCA 537 447 11800 Antisense
GCCAGTCGACGACAATCTGTTTATG 173 281 11845 Antisense
AAGCAAATCGTGTTTCTACCAGTCG 266 151 11909 Antisense
TCTACCAGTCGCCCAAATGGAGATC 132 613 11923 Antisense
TTCGTCACACAATTCAAGTTCATCC 633 693 11957 Antisense
AGCTCTGGATATACGGAAACCCTCA 32 81 11986 Antisense
GAACACACATCATCCAACTATCAAC 266 353 12019 Antisense
GAACGATCTGTCTCACCAAGAAACC 524 347 12049 Antisense
GAATACTCCAGACGGCAGATCTACA 365 327 12129 Antisense
GATCTACATCTGCCAGTGTTGTATC 156 419 12146 Antisense
Sequence Source Affymetrix Proprietary Database