[Home] | [Total List]

[191589_s_at] 7TM chemoreceptor, srh family

Description F47D2.10 /REP_DB=WormBase Gene ID /WP=CE24989 /GEN=srh-194 /TR=Q9GS02 /GB=AAG24118.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=chemoreceptor
Cluster 6grp_total > 43      4grp_total > 01      6grp_cgc > 80      

Scale

Warning: fopen(./gnuplot/191589_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 98
1 2 3 4 range
A 26.6
(-1.4)
A
1.2
(-3)
A
19.2
(-1.9)
A
98.9
(3)
P
98
B 24.8
(1.1)
A
2.1
(-3)
A
10.6
(-1.5)
A
35.3
(3)
P
33
C 2
(-3)
A
3.2
(-2.9)
A
11.6
(-2)
A
58.2
(3)
M
56
avr 17.8
(-1.5)
2.2
(-3)
13.8
(-1.9)
64.1
(3)
62

Warning: fopen(./gnuplot/191589_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 42
1 2 3 4 5 6 range
A 44.1
(2.8)
A
14.6
(-1.6)
A
45.2
(3)
A
5.2
(-3)
A
30.7
(0.8)
A
26.9
(0.3)
A
40
B 25.6
(2.6)
A
16.4
(0.3)
A
23.8
(2.1)
A
3.3
(-3)
A
27.2
(3)
A
4.7
(-2.6)
A
24
C 2.8
(-3)
A
23.4
(0.7)
A
18.3
(-0.2)
A
36.3
(3)
A
3
(-3)
A
8.5
(-2)
A
34
avr 24.2
(1.1)
18.1
(-1.2)
29.1
(3)
14.9
(-2.4)
20.3
(-0.4)
13.4
(-3)
16
No Scale

Warning: fopen(./gnuplot/191589_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 14
1 2 3 4 range
A 9.7
(1)
A
0.3
(-3)
A
5
(-1)
A
14.5
(3)
P
14
B 7.9
(3)
A
0.5
(-3)
A
2.5
(-1.4)
A
7.5
(2.7)
P
7
C 0.7
(-3)
A
0.9
(-2.9)
A
4
(-0.8)
A
9.8
(3)
M
9
avr 6.1
(0.3)
0.6
(-3)
3.8
(-1.1)
10.6
(3)
10

Warning: fopen(./gnuplot/191589_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191589_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 10
1 2 3 4 5 6 range
A 8.1
(1.8)
A
5.2
(-0.2)
A
9.8
(3)
A
1.3
(-3)
A
9.3
(2.6)
A
6.6
(0.7)
A
9
B 8.9
(1.8)
A
5.5
(-0.3)
A
5.8
(-0.1)
A
0.9
(-3)
A
11
(3)
A
1.8
(-2.5)
A
10
C 1
(-3)
A
7.1
(2.8)
A
4.6
(0.4)
A
7.3
(3)
A
1
(-3)
A
2.9
(-1.2)
A
6
avr 6
(1.3)
5.9
(1.2)
6.7
(2.4)
3.2
(-3)
7.1
(3)
3.8
(-2.1)
4
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 191589_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14948
Sequence Type Exemplar sequence
Representative Public ID F47D2.10 NCBI
Target Description F47D2.10 /REP_DB=WormBase Gene ID /WP=CE24989 /GEN=srh-194 /TR=Q9GS02 /GB=AAG24118.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=chemoreceptor
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071782(11), NM_001028775(11), NM_001028774(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071782 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-193) (srh-193) mRNA, complete cds. 11/11 A 
NM_001028775 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-194) (srh-194) mRNA, complete cds. 11/11 None
NM_001028774 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-194) (srh-194) mRNA, complete cds. 11/11 None
SNAP00000032773 ENSEMBL cdna:SNAP chromosome:CEL140:V:4288226:4290007:-1 11/11 None
SNAP00000032775 ENSEMBL cdna:SNAP chromosome:CEL140:V:4291650:4292254:-1 11/11 None
GENEFINDER00000032778 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:4291650:4294327:-1 11/11 None
F47D2.9 ENSEMBL cdna:known chromosome:CEL140:V:4288226:4290007:-1 gene:F47D2.9 11/11 A 
F47D2.10b ENSEMBL cdna:known chromosome:CEL140:V:4291650:4293324:-1 gene:F47D2.10 11/11 None
F47D2.10a ENSEMBL cdna:known chromosome:CEL140:V:4291650:4293299:-1 gene:F47D2.10 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:4291649-4293324(-) 100.0 100.0
Public Domain and Genome References
Gene Title 7TM chemoreceptor, srh family
Gene Symbol srh-193
Ensembl F47D2.9
F47D2.10
Entrez Gene 185930 Entrez gene
SwissProt Q22989 EMBL-EBI
WormBase CE35973 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAG24117 Serpentine receptor, class h protein 193 [Caenorhabditis elegans] ref|NP_504183.2| Serpentine Receptor, class H family member (srh-193) [Caenorhabditis elegans] 0.0
blast AAW88397 Serpentine receptor, class h protein 194, isoform b [Caenorhabditis elegans] ref|NP_001023946.1| Serpentine Receptor, class H family member (srh-194) [Caenorhabditis elegans] 0.0
blast AAW88397 Serpentine receptor, class h protein 194, isoform b [Caenorhabditis elegans] ref|NP_001023946.1| Serpentine Receptor, class H family member (srh-194) [Caenorhabditis elegans] 1.0E-172
blast AAG24117 Serpentine receptor, class h protein 193 [Caenorhabditis elegans] ref|NP_504183.2| Serpentine Receptor, class H family member (srh-193) [Caenorhabditis elegans] 1.0E-164
blast T25786 hypothetical protein F47D2.9 - Caenorhabditis elegans 1.0E-163
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 9.2E-109
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 4.0E-64
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 5.0E-78
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 9.2E-83
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_504183.2 7 20-42,55-77,97-119,140-162,198-220,241-263,278-300
NP_001023946.1 7 20-42,55-77,97-119,140-162,197-219,240-262,277-299
NP_001023945.1 4 32-51,87-109,130-152,167-189
F47D2.9 7 20-42,55-77,97-119,140-162,198-220,241-263,278-300
F47D2.10b 7 20-42,55-77,97-119,140-162,197-219,240-262,277-299
F47D2.10a 4 32-51,87-109,130-152,167-189
SNAP00000032773 5 20-42,55-77,122-144,165-187,202-224
SNAP00000032775 3 41-63,84-106,121-143
GENEFINDER00000032778 7 20-37,44-66,95-117,138-160,195-217,238-260,275-297
Sequence
Target Sequence
>C. ELEGANS:191589_S_AT
attacttatcactttatcatatcagtcatatttgttgttctttgttgtcttgaaattagc
gtatttgttggatatcttgcctcaaacagcttggagcaattgaagcaaaaacggatgtcc
ccgaaaacatttcaacttcagaaaaagttttttatagtcctagtcattcaaatgtcaatt
ccgttgatatgttttctatttccacttatttctgcagcactgtcagttttactcaattat
tacaaccagggaatgattaatactggacttataatagcttcattgcatggaattgtttca
acagtcactatgcttctacttcatagaccatatcggagagc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATTACTTATCACTTTATCATATCAG 292 13 589 Antisense
GTTGGATATCTTGCCTCAAACAGCT 123 437 655 Antisense
ATCTTGCCTCAAACAGCTTGGAGCA 390 29 662 Antisense
GGATGTCCCCGAAAACATTTCAACT 220 515 701 Antisense
TTATAGTCCTAGTCATTCAAATGTC 701 677 740 Antisense
TTGATATGTTTTCTATTTCCACTTA 142 705 772 Antisense
TATTTCCACTTATTTCTGCAGCACT 139 663 785 Antisense
TCTGCAGCACTGTCAGTTTTACTCA 416 609 799 Antisense
TTTACTCAATTATTACAACCAGGGA 611 613 816 Antisense
AATACTGGACTTATAATAGCTTCAT 217 173 847 Antisense
TACTTCATAGACCATATCGGAGAGC 521 645 905 Antisense
Sequence Source Affymetrix Proprietary Database