[Home] | [Total List]

[191588_at]

Description F47D2.10 /REP_DB=WormBase Gene ID /WP=CE24989 /GEN=srh-194 /TR=Q9GS02 /GB=AAG24118.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=chemoreceptor
Cluster 6grp_total > 33      4grp_total > 06      6grp_cgc > 81      6grp_cgc_sub > 03      

Scale

Warning: fopen(./gnuplot/191588_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 60
1 2 3 4 range
A 44.4
(1.2)
A
3
(-3)
A
37.8
(0.6)
A
61.6
(3)
A
59
B 31.6
(2)
A
3.1
(-3)
A
37.4
(3)
A
27.3
(1.2)
A
34
C 36
(0.1)
A
21.6
(-1.5)
A
7.3
(-3)
A
63.2
(3)
A
56
avr 37.3
(1.1)
9.2
(-3)
27.5
(-0.4)
50.7
(3)
42

Warning: fopen(./gnuplot/191588_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 53
1 2 3 4 5 6 range
A 55.8
(3)
A
4.9
(-2.8)
A
32.5
(0.3)
A
3.2
(-3)
A
22.7
(-0.8)
A
7.5
(-2.5)
A
53
B 36.1
(0.5)
A
55.9
(3)
A
47.4
(1.9)
A
34.3
(0.3)
A
18.6
(-1.7)
A
8
(-3)
A
48
C 13.4
(-1.7)
A
45.7
(2.4)
A
50.6
(3)
A
9.5
(-2.2)
A
2.9
(-3)
A
11.6
(-1.9)
A
48
avr 35.1
(1.5)
35.5
(1.6)
43.5
(3)
15.7
(-1.8)
14.7
(-2)
9
(-3)
35
No Scale

Warning: fopen(./gnuplot/191588_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 16
1 2 3 4 range
A 16.2
(3)
A
0.7
(-3)
A
9.9
(0.6)
A
9
(0.2)
A
16
B 10.1
(3)
A
0.8
(-3)
A
8.7
(2.1)
A
5.8
(0.2)
A
9
C 11.9
(3)
A
6.2
(-0.6)
A
2.5
(-3)
A
10.7
(2.2)
A
9
avr 12.7
(3)
2.6
(-3)
7
(-0.4)
8.5
(0.5)
10

Warning: fopen(./gnuplot/191588_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191588_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 18
1 2 3 4 5 6 range
A 10.3
(3)
A
1.7
(-2.4)
A
7.1
(1)
A
0.8
(-3)
A
6.9
(0.9)
A
1.8
(-2.4)
A
10
B 12.5
(0.7)
A
18.6
(3)
A
11.5
(0.3)
A
9.1
(-0.7)
A
7.5
(-1.3)
A
3
(-3)
A
16
C 5
(-1.1)
A
14
(3)
A
12.9
(2.5)
A
1.9
(-2.5)
A
0.9
(-3)
A
3.9
(-1.6)
A
13
avr 9.3
(1.5)
11.4
(3)
10.5
(2.4)
3.9
(-2.3)
5.1
(-1.4)
2.9
(-3)
9
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 191588_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14948
Sequence Type Exemplar sequence
Representative Public ID F47D2.10 NCBI
Target Description F47D2.10 /REP_DB=WormBase Gene ID /WP=CE24989 /GEN=srh-194 /TR=Q9GS02 /GB=AAG24118.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=chemoreceptor
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_001028775(11), NM_001028774(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_001028775 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-194) (srh-194) mRNA, complete cds. 11/11 None
NM_001028774 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-194) (srh-194) mRNA, complete cds. 11/11 None
GENEFINDER00000032778 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:4291650:4294327:-1 11/11 None
F47D2.10b ENSEMBL cdna:known chromosome:CEL140:V:4291650:4293324:-1 gene:F47D2.10 11/11 None
F47D2.10a ENSEMBL cdna:known chromosome:CEL140:V:4291650:4293299:-1 gene:F47D2.10 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000032775 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:4291649-4293324(-) 100.0 100.0
Public Domain and Genome References
Ensembl F47D2.10
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAW88397 Serpentine receptor, class h protein 194, isoform b [Caenorhabditis elegans] ref|NP_001023946.1| Serpentine Receptor, class H family member (srh-194) [Caenorhabditis elegans] 0.0
blast AAG24117 Serpentine receptor, class h protein 193 [Caenorhabditis elegans] ref|NP_504183.2| Serpentine Receptor, class H family member (srh-193) [Caenorhabditis elegans] 1.0E-164
blast T25786 hypothetical protein F47D2.9 - Caenorhabditis elegans 1.0E-161
blast AAW88397 Serpentine receptor, class h protein 194, isoform b [Caenorhabditis elegans] ref|NP_001023946.1| Serpentine Receptor, class H family member (srh-194) [Caenorhabditis elegans] 1.0E-140
blast T25786 hypothetical protein F47D2.9 - Caenorhabditis elegans 1.0E-120
blast AAG24118 Serpentine receptor, class h protein 194, isoform a [Caenorhabditis elegans] ref|NP_001023945.1| Serpentine Receptor, class H family member (srh-194) [Caenorhabditis elegans] 1.0E-119
blast AAW88397 Serpentine receptor, class h protein 194, isoform b [Caenorhabditis elegans] ref|NP_001023946.1| Serpentine Receptor, class H family member (srh-194) [Caenorhabditis elegans] 1.0E-119
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 9.2E-109
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_001023946.1 7 20-42,55-77,97-119,140-162,197-219,240-262,277-299
NP_001023945.1 4 32-51,87-109,130-152,167-189
F47D2.10b 7 20-42,55-77,97-119,140-162,197-219,240-262,277-299
F47D2.10a 4 32-51,87-109,130-152,167-189
GENEFINDER00000032778 7 20-37,44-66,95-117,138-160,195-217,238-260,275-297
Sequence
Target Sequence
>C. ELEGANS:191588_AT
caccactgggtatatttgaggcgtttatggttagctgctcattacgtcatcgtagtattt
ttaatgctccctatggtattccttgtccctgaagaaaatattgctcagcacattttcgag
caacttccatgtttacctagctatatttataatgctccagtgtttgtttttactgaagat
attacttatcactttatcatatcagtcatatttgttgttctttgttgtcttgaaattagc
gtatttgttggatatcttgcctcaaacagcttggagcaattgaagcaaaaacggatgtcc
ccgaaaacatttcaacttcagaaaaagttttttatagtcctagtcattcaaatgtcaatt
ccgttgatatgttttctatttccacttatttctgcagcactgtcagttttactcaattat
tacaaccagggaatgattaatactggacttataatagcttcattgcatggaattgtttca
acagtcactatgcttctacttcatagaccatatcggagagcagtgaaagcaattttctat
aaatctgaaatgagcaaccagacggaagattcacaaagtcgggctttcaagctacggcat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CACCACTGGGTATATTTGAGGCGTT 512 197 409 Antisense
TTAGCTGCTCATTACGTCATCGTAG 242 679 439 Antisense
ATCGTAGTATTTTTAATGCTCCCTA 676 35 457 Antisense
TTTAATGCTCCCTATGGTATTCCTT 470 673 468 Antisense
ATGGTATTCCTTGTCCCTGAAGAAA 419 49 481 Antisense
AATATTGCTCAGCACATTTTCGAGC 292 173 505 Antisense
TCCATGTTTACCTAGCTATATTTAT 141 591 534 Antisense
GCTCCAGTGTTTGTTTTTACTGAAG 421 295 562 Antisense
AACAGTCACTATGCTTCTACTTCAT 548 137 888 Antisense
GAGCAACCAGACGGAAGATTCACAA 381 391 960 Antisense
AAGTCGGGCTTTCAAGCTACGGCAT 195 159 984 Antisense
Sequence Source Affymetrix Proprietary Database