[Home] | [Total List]

[191547_s_at] 7TM chemoreceptor, srh family /// 7TM chemoreceptor, srh family

Description Y49F6A.3 /REP_DB=WormBase Gene ID /WP=CE24393 /GEN=srh-305 /TR=Q9N3L9 /GB=AAF60723.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=chemoreceptor
Cluster 6grp_total > 44      4grp_total > 05      6grp_cgc > 06      6grp_cgc_sub > Cu      

Scale

Warning: fopen(./gnuplot/191547_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 147
1 2 3 4 range
A 34.5
(-1.7)
A
3.2
(-3)
A
37.6
(-1.6)
A
149.7
(3)
P
147
B 45.5
(0)
A
10.6
(-2.8)
A
8.3
(-3)
A
82
(3)
A
74
C 61.3
(2.9)
A
4.7
(-3)
A
9.5
(-2.5)
A
62.1
(3)
P
57
avr 47.1
(-0.3)
6.2
(-3)
18.5
(-2.2)
97.9
(3)
92

Warning: fopen(./gnuplot/191547_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 48
1 2 3 4 5 6 range
A 48.1
(2.6)
A
10
(-2.3)
A
51.6
(3)
A
7
(-2.7)
A
4.3
(-3)
A
32.2
(0.5)
A
47
B 24.8
(0.9)
A
36.1
(3)
A
5.8
(-2.5)
A
3.2
(-3)
A
32.4
(2.3)
A
28.1
(1.5)
A
33
C 28.5
(1.2)
A
18.3
(-0.9)
A
37.3
(3)
A
7.7
(-3)
A
25.7
(0.6)
A
13.3
(-1.9)
A
30
avr 33.8
(3)
21.5
(0.3)
31.6
(2.5)
6
(-3)
20.8
(0.2)
24.5
(1)
28
No Scale

Warning: fopen(./gnuplot/191547_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 21
1 2 3 4 range
A 12.6
(0.4)
A
0.7
(-3)
A
9.8
(-0.4)
A
21.9
(3)
P
21
B 14.5
(1.8)
A
2.6
(-2.7)
A
1.9
(-3)
A
17.5
(3)
A
16
C 20.3
(3)
A
1.4
(-3)
A
3.3
(-2.4)
A
10.5
(-0.1)
P
19
avr 15.8
(2.7)
1.6
(-3)
5
(-1.6)
16.6
(3)
15

Warning: fopen(./gnuplot/191547_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191547_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12
1 2 3 4 5 6 range
A 8.9
(1.6)
A
3.6
(-1.6)
A
11.2
(3)
A
1.8
(-2.7)
A
1.3
(-3)
A
7.8
(0.9)
A
10
B 8.6
(0.8)
A
12
(2.5)
A
1.4
(-2.8)
A
0.9
(-3)
A
13.1
(3)
A
10.5
(1.7)
A
12
C 10.5
(3)
A
5.6
(-0.3)
A
9.5
(2.3)
A
1.6
(-3)
A
8.3
(1.5)
A
4.5
(-1)
A
9
avr 9.3
(3)
7.1
(1.3)
7.4
(1.6)
1.4
(-3)
7.6
(1.7)
7.6
(1.7)
8
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 191547_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4387
Sequence Type Exemplar sequence
Representative Public ID Y49F6A.3 NCBI
Target Description Y49F6A.3 /REP_DB=WormBase Gene ID /WP=CE24393 /GEN=srh-305 /TR=Q9N3L9 /GB=AAF60723.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=chemoreceptor
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062189(11), NM_062190(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062189 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-57) (srh-57) mRNA, complete cds. 11/11 None
NM_062190 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-305) (srh-305) mRNA, complete cds. 11/11 None
GENEFINDER00000032338 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:3588277:3589715:1 11/11 None
GENEFINDER00000032342 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:3592045:3593483:-1 11/11 None
Y49F6A.2 ENSEMBL cdna:known chromosome:CEL140:II:3588277:3589715:1 gene:Y49F6A.2 11/11 None
Y49F6A.3 ENSEMBL cdna:known chromosome:CEL140:II:3592045:3593483:-1 gene:Y49F6A.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:3586649-3589714(+) 98.64 100.0
chrII:3592043-3595108(-) 98.64 100.0
Public Domain and Genome References
Gene Title 7TM chemoreceptor, srh family
7TM chemoreceptor, srh family
Gene Symbol srh-57
srh-305
Ensembl Y49F6A.2
Y49F6A.3
Entrez Gene 191864 Entrez gene
191899 Entrez gene
SwissProt Q9N3M0 EMBL-EBI
WormBase CE24393 Wormbase
CE24393 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF60723 Serpentine receptor, class h protein 305 [Caenorhabditis elegans] gb|AAF60725.1| Serpentine receptor, class h protein 57 [Caenorhabditis elegans] ref|NP_494591.1| Serpentine Receptor, class H family member (srh-305) [Caenorhabditis elegans] ref|NP_494590.1| Serpentine Receptor, class H family member (srh-57) [Caenorhabditis elegans] 1.0E-164
blast AAG24217 Serpentine receptor, class h protein 60 [Caenorhabditis elegans] ref|NP_494589.1| Serpentine Receptor, class H family member (srh-60) [Caenorhabditis elegans] 1.0E-128
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_494590.1 7 25-47,75-97,107-125,146-165,202-224,252-274,289-307
NP_494591.1 7 25-47,75-97,107-125,146-165,202-224,252-274,289-307
Y49F6A.2 7 25-47,75-97,107-125,146-165,202-224,252-274,289-307
Y49F6A.3 7 25-47,75-97,107-125,146-165,202-224,252-274,289-307
GENEFINDER00000032338 7 25-47,75-97,107-125,146-165,202-224,252-274,289-307
GENEFINDER00000032342 7 25-47,75-97,107-125,146-165,202-224,252-274,289-307
Sequence
Target Sequence
>C. ELEGANS:191547_S_AT
gtttctgttctgatgcttggtgtgagctttatcatgttgtatgaaaaccggcagagtcaa
atttcaacggtgaagtttaagataaaaaggaaagaaactcgaatattatattatgctgca
aactatttattttcatttactgtgatggtttcattctatatacataactcggatcaggtg
gagttgaggaagtttgcgtttaagaaaatcccttgtcccactattgaatttttcgattcc
aaaacatatgtcctattgaaaagtggagaagttatcccgctcatatcaactattagcgga
tttgtgtgtattggtgttcagacgtttttctttctattccatactatataccatctaacg
tgtgtcggaagcgcaacggtttcagagtcagcaaaaaagctgcagaggatgtttttgaag
attgtttcggttcagatttcaattcccttgatagcaattgtcctcccagttttatactcg
atgtatgcggataacacgagctattataatcaagcagctaacaacaacgcgatgatagtt
atggctaatcatggattgctgagcacctgctgcacacttcttatctataaacc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTTTCTGTTCTGATGCTTGGTGTGA 328 451 931 Antisense
ATCCCTTGTCCCACTATTGAATTTT 311 37 1138 Antisense
GTTATCCCGCTCATATCAACTATTA 547 447 1201 Antisense
GTGTGTATTGGTGTTCAGACGTTTT 678 487 1234 Antisense
CAGACGTTTTTCTTTCTATTCCATA 583 205 1249 Antisense
TATTCCATACTATATACCATCTAAC 221 665 1265 Antisense
ACCATCTAACGTGTGTCGGAAGCGC 210 83 1280 Antisense
AGCGCAACGGTTTCAGAGTCAGCAA 16 83 1300 Antisense
TTCGGTTCAGATTTCAATTCCCTTG 519 695 1356 Antisense
TGTCCTCCCAGTTTTATACTCGATG 479 555 1389 Antisense
GCTGCACACTTCTTATCTATAAACC 377 297 1499 Antisense
Sequence Source Affymetrix Proprietary Database