[Home] | [Total List]

[191377_s_at] G-protein coupled receptor

Description C24A8.1 /REP_DB=WormBase Gene ID /WP=CE08337 /TR=P91096 /GB=AAK39179.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=G-protein coupled receptor
Cluster 6grp_total > 25      4grp_total > 15      6grp_total_sub > Decrease      

Scale

Warning: fopen(./gnuplot/191377_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 88
1 2 3 4 range
A 77.4
(3)
P
13.6
(-3)
A
41.8
(-0.3)
A
76.2
(2.9)
P
64
B 87.2
(3)
P
15.1
(-3)
A
38
(-1.1)
A
76.7
(2.1)
A
72
C 96.8
(3)
P
9.8
(-3)
A
31.2
(-1.5)
A
97.3
(3)
A
88
avr 87.1
(3)
12.8
(-3)
37
(-1)
83.4
(2.7)
74

Warning: fopen(./gnuplot/191377_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 163
1 2 3 4 5 6 range
A 130.8
(3)
A
103.7
(0.9)
A
72.3
(-1.5)
A
53.9
(-2.9)
A
52.9
(-3)
A
67.3
(-1.9)
A
78
B 160.3
(2.4)
M
175.9
(3)
P
17.6
(-3)
A
59.9
(-1.4)
A
55.8
(-1.6)
M
51.7
(-1.7)
A
158
C 110.6
(1.7)
P
136.4
(3)
A
80.8
(0.3)
A
81.1
(0.3)
A
13.2
(-3)
A
48.4
(-1.3)
M
123
avr 133.9
(2.7)
138.7
(3)
56.9
(-2)
65
(-1.5)
40.6
(-3)
55.8
(-2.1)
98
No Scale

Warning: fopen(./gnuplot/191377_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 29
1 2 3 4 range
A 28.2
(3)
P
2.9
(-3)
A
10.9
(-1.1)
A
11.2
(-1)
P
25
B 27.8
(3)
P
3.7
(-3)
A
8.8
(-1.7)
A
16.3
(0.1)
A
24
C 32
(3)
P
2.8
(-3)
A
10.9
(-1.3)
A
16.4
(-0.2)
A
29
avr 29.3
(3)
3.1
(-3)
10.2
(-1.4)
14.6
(-0.4)
26

Warning: fopen(./gnuplot/191377_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191377_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 54
1 2 3 4 5 6 range
A 24.1
(-0.3)
A
36.9
(3)
A
15.7
(-2.5)
A
13.7
(-3)
A
16
(-2.4)
A
16.4
(-2.3)
A
23
B 55.8
(2.7)
M
58.6
(3)
P
4.3
(-3)
A
15.9
(-1.7)
A
22.7
(-1)
M
19.3
(-1.3)
A
54
C 41
(2.9)
P
41.6
(3)
A
20.6
(-0.4)
A
16.3
(-1.1)
A
4.3
(-3)
A
16.2
(-1.1)
M
37
avr 40.3
(2)
45.7
(3)
13.5
(-3)
15.3
(-2.7)
14.3
(-2.9)
17.3
(-2.3)
32
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 191377_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.16089
Sequence Type Exemplar sequence
Representative Public ID C24A8.1 NCBI
Target Description C24A8.1 /REP_DB=WormBase Gene ID /WP=CE08337 /TR=P91096 /GB=AAK39179.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=G-protein coupled receptor
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076338(11), NM_076340(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076338 NCBI Caenorhabditis elegans C24A8.1 (C24A8.1) mRNA, complete cds. 11/11 A 
NM_076340 NCBI Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-306) (tag-306) mRNA, complete cds. 11/11 A 
GENEFINDER00000036350 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:4320837:4327305:1 11/11 None
C24A8.1 ENSEMBL cdna:known chromosome:CEL140:X:4320837:4326323:1 gene:C24A8.1 11/11 A 
C24A8.4a ENSEMBL cdna:known chromosome:CEL140:X:4330052:4336008:-1 gene:C24A8.4 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000036343 3/11 Cross Hyb Matching Probes None
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
180707 2 1 NM_076340 191377_s_at (11), 191419_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:4320837-4326324(+) 100.0 100.0
Public Domain and Genome References
Gene Title G-protein coupled receptor
Ensembl C24A8.1
C24A8.4
Entrez Gene 180706 Entrez gene
SwissProt P91096 EMBL-EBI
WormBase CE08337 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
7186 G-protein coupled receptor protein signaling pathway inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
1584 rhodopsin-like receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK39179 Hypothetical protein C24A8.1 [Caenorhabditis elegans] ref|NP_508739.1| C24A8.1 [Caenorhabditis elegans] 0.0
blast AAK39183 Temporarily assigned gene name protein 306, isoform a [Caenorhabditis elegans] ref|NP_508741.2| Temporarily Assigned Gene name family member (tag-306) [Caenorhabditis elegans] 0.0
blast AAK39182 Temporarily assigned gene name protein 306, isoform b [Caenorhabditis elegans] ref|NP_508742.1| Temporarily Assigned Gene name family member (tag-306) [Caenorhabditis elegans] 0.0
blast AAK68327 Hypothetical protein F14H12.4b [Caenorhabditis elegans] ref|NP_001024575.1| F14H12.4b [Caenorhabditis elegans] 0.0
blast CAE68558 Hypothetical protein CBG14393 [Caenorhabditis briggsae] 0.0
blast AAK39179 Hypothetical protein C24A8.1 [Caenorhabditis elegans] ref|NP_508739.1| C24A8.1 [Caenorhabditis elegans] 1.0E-139
Protein Families
Method ID Description E-Value
ec A2S7_HUMAN (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) 8.0E-65
ec A2S7_HUMAN (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) 4.0E-65
hanks 2.1.17 CaMK Group; CaMK I Regulated by Ca2+/CaM and close relatives; TWITCH 2.0E-71
hanks 2.1.17 CaMK Group; CaMK I Regulated by Ca2+/CaM and close relatives; TWITCH 1.0E-71
Protein Domains
Database ID Description E-Value
Pfam IPR000276 EMBL-EBI Rhodopsin-like GPCR superfamily 1.5E-61
Pfam IPR000719 EMBL-EBI Protein kinase 8.5E-93
Pfam IPR000276 EMBL-EBI Rhodopsin-like GPCR superfamily 2.2E-19
Pfam IPR000276 EMBL-EBI Rhodopsin-like GPCR superfamily 6.1E-17
Pfam IPR000276 EMBL-EBI Rhodopsin-like GPCR superfamily 5.0E-63
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_508739.1 7 26-48,63-85,106-128,155-174,277-299,314-333,340-362
NP_508741.2 2 494-516,531-553
C24A8.1 7 26-48,63-85,106-128,155-174,277-299,314-333,340-362
C24A8.4a 2 447-469,484-506
GENEFINDER00000036350 6 26-48,63-85,106-128,155-174,485-507,522-544
Sequence
Target Sequence
>C. ELEGANS:191377_S_AT
gggcgctggacctgttagcaaaactgaaatccaagcagggaatggcgattcgtcgagaga
ctcgtgcaaccaagttggttgcaactgtaatggtggtttttctcgtctgctggcttccgt
ttttcacattgaacatgatcaaaatttacaaattgatattcaacgtttggtcagcggacc
tcgaaatttggttccattggtttaccgcactggggtatttgaattcgtcactcaactttt
tcatttactcaacaatcaatccagtaagcatttttatatcaaatttgatatcgaaaaaga
ttatatttttaatttttcaagttcaatttgcgttgtataaaacattaattcatggaattg
agacaagaaattccgtcattcattccgccgcttacttggcttccgtcgatcttctcgacg
tcagagagaaaaatcgtggatgttaccgccacgagatagcagc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGGCGCTGGACCTGTTAGCAAAACT 450 489 767 Antisense
GAATGGCGATTCGTCGAGAGACTCG 260 333 806 Antisense
GAGAGACTCGTGCAACCAAGTTGGT 316 381 821 Antisense
CTGTAATGGTGGTTTTTCTCGTCTG 439 219 851 Antisense
TGGCTTCCGTTTTTCACATTGAACA 606 543 877 Antisense
TATTCAACGTTTGGTCAGCGGACCT 627 661 923 Antisense
AGCGGACCTCGAAATTTGGTTCCAT 178 81 939 Antisense
TTGGTTCCATTGGTTTACCGCACTG 134 705 954 Antisense
GCACTGGGGTATTTGAATTCGTCAC 120 313 973 Antisense
CTTCCGTCGATCTTCTCGACGTCAG 30 219 1166 Antisense
GATGTTACCGCCACGAGATAGCAGC 100 409 1205 Antisense
Sequence Source Affymetrix Proprietary Database