[Home] | [Total List]

[191376_at] G-protein coupled receptor

Description C24A8.1 /REP_DB=WormBase Gene ID /WP=CE08337 /TR=P91096 /GB=AAK39179.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=G-protein coupled receptor
Cluster 6grp_total > 11      4grp_total > 39      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/191376_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 30
1 2 3 4 range
A 3.5
(-0.1)
A
3.1
(-0.6)
A
1.4
(-3)
A
5.7
(3)
A
4
B 31.8
(3)
A
3.1
(-3)
A
4.6
(-2.7)
A
3.6
(-2.9)
A
29
C 5
(-1.5)
A
6.2
(3)
A
4.6
(-3)
A
6.2
(3)
A
2
avr 13.4
(3)
4.1
(-2.6)
3.5
(-3)
5.2
(-2)
10

Warning: fopen(./gnuplot/191376_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 13
1 2 3 4 5 6 range
A 8.4
(0.4)
A
13.8
(3)
A
2.1
(-2.7)
A
1.4
(-3)
A
4.5
(-1.5)
A
2.6
(-2.4)
A
12
B 3.2
(-1.3)
A
2.2
(-2)
A
1
(-2.9)
A
3.4
(-1.1)
A
8.9
(3)
A
0.9
(-3)
A
8
C 4
(-2.1)
A
2.3
(-3)
A
13.5
(3)
A
2.3
(-3)
A
5.5
(-1.3)
A
4.1
(-2)
A
11
avr 5.2
(1.3)
6.1
(2.7)
5.5
(1.8)
2.4
(-3)
6.3
(3)
2.5
(-2.8)
4
No Scale

Warning: fopen(./gnuplot/191376_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 10
1 2 3 4 range
A 1.3
(3)
A
0.7
(-1)
A
0.4
(-3)
A
0.8
(-0.3)
A
1
B 10.2
(3)
A
0.8
(-3)
A
1.1
(-2.8)
A
0.8
(-3)
A
9
C 1.7
(2.3)
A
1.8
(3)
A
1.6
(1.5)
A
1
(-3)
A
1
avr 4.4
(3)
1.1
(-2.7)
1
(-2.8)
0.9
(-3)
4

Warning: fopen(./gnuplot/191376_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/191376_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 5
1 2 3 4 5 6 range
A 1.5
(-1.4)
A
4.9
(3)
A
0.5
(-2.7)
A
0.3
(-3)
A
1.4
(-1.6)
A
0.6
(-2.6)
A
5
B 1.1
(-1.5)
A
0.7
(-2.3)
A
0.3
(-3)
A
0.9
(-1.9)
A
3.6
(3)
A
0.3
(-3)
A
3
C 1.5
(-0.9)
A
0.7
(-2.6)
A
3.4
(3)
A
0.5
(-3)
A
1.8
(-0.3)
A
1.4
(-1.1)
A
3
avr 1.4
(-0.2)
2.1
(2.3)
1.4
(-0.2)
0.6
(-3)
2.3
(3)
0.8
(-2.3)
2
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 191376_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.16089
Sequence Type Exemplar sequence
Representative Public ID C24A8.1 NCBI
Target Description C24A8.1 /REP_DB=WormBase Gene ID /WP=CE08337 /TR=P91096 /GB=AAK39179.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=G-protein coupled receptor
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076338(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076338 NCBI Caenorhabditis elegans C24A8.1 (C24A8.1) mRNA, complete cds. 11/11 A 
C24A8.1 ENSEMBL cdna:known chromosome:CEL140:X:4320837:4326323:1 gene:C24A8.1 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_076340 1/11 Cross Hyb Matching Probes None
SNAP00000036341 5/11 Cross Hyb Matching Probes None
GENEFINDER00000036350 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:4320837-4326324(+) 100.0 100.0
Public Domain and Genome References
Gene Title G-protein coupled receptor
Ensembl C24A8.1
Entrez Gene 180706 Entrez gene
SwissProt P91096 EMBL-EBI
WormBase CE08337 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
7186 G-protein coupled receptor protein signaling pathway inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
1584 rhodopsin-like receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK39179 Hypothetical protein C24A8.1 [Caenorhabditis elegans] ref|NP_508739.1| C24A8.1 [Caenorhabditis elegans] 0.0
blast CAE68558 Hypothetical protein CBG14393 [Caenorhabditis briggsae] 3.0E-96
blast AAK39183 Temporarily assigned gene name protein 306, isoform a [Caenorhabditis elegans] ref|NP_508741.2| Temporarily Assigned Gene name family member (tag-306) [Caenorhabditis elegans] 1.0E-45
Protein Domains
Database ID Description E-Value
Pfam IPR000276 EMBL-EBI Rhodopsin-like GPCR superfamily 1.5E-61
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_508739.1 7 26-48,63-85,106-128,155-174,277-299,314-333,340-362
C24A8.1 7 26-48,63-85,106-128,155-174,277-299,314-333,340-362
Sequence
Target Sequence
>C. ELEGANS:191376_AT
gtcattggcattgcacccaagaatagaaacatgatcacttgggaaaagcctcttctcaaa
aaaattgaagagactgcagcagaacacgcgagttcattgaacgacagtgaacgagagcag
gactgggcgctggacctgttagcaaaactgaaatccaagcagggaatggcgattcgtcga
gagactcgtgcaaccaagttggttgcaactgtaatggtggtttttctcgtctgctggctt
ccgtttttcacattgaacatgatcaaaatttacaaattgatattcaacgtttggtcagcg
gacctcgaaatttggttccattggtttaccgcactggggtatttgaattcgtcactcaac
tttttcatttactcaacaatcaatccagtaagcatttttatatcaaatttgatatcgaaa
aagattatatttttaatttttcaagttcaatttgcgttgtataaaacattaattcatgga
attgagacaagaaattccgtcattcattccgccgcttacttggcttccgtcgatcttctc
gacgtcagagagaaaaatcgtggatgttaccgccacgagatagcagcagaggtcctgcaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTCATTGGCATTGCACCCAAGAATA 249 467 643 Antisense
GAATAGAAACATGATCACTTGGGAA 488 325 663 Antisense
CACTTGGGAAAAGCCTCTTCTCAAA 41 195 678 Antisense
GAGACTGCAGCAGAACACGCGAGTT 503 393 712 Antisense
AGAACACGCGAGTTCATTGAACGAC 474 73 723 Antisense
GAACGACAGTGAACGAGAGCAGGAC 650 347 741 Antisense
AACGAGAGCAGGACTGGGCGCTGGA 291 143 752 Antisense
AACAATCAATCCAGTAAGCATTTTT 656 131 1017 Antisense
ATTTTTCAAGTTCAATTTGCGTTGT 413 1 1078 Antisense
TTGAGACAAGAAATTCCGTCATTCA 662 703 1124 Antisense
CGAGATAGCAGCAGAGGTCCTGCAA 554 249 1218 Antisense
Sequence Source Affymetrix Proprietary Database