[Home] | [Total List]

[190719_at] glucuronosyltransferase

Description F10D2.6 /REP_DB=WormBase Gene ID /WP=CE09317 /TR=O16915 /GB=AAC48236.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=glucuronosyltransferase
Cluster 6grp_highest_10_10 > 76      6grp_high1_10_10 > 67      6grp_highest_nonorm > 99      6grp_total > 67      4grp_total > 02      6grp_highest_sub > Da      6grp_cgc > 38      6grp_high1_sub > Da      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/190719_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 10978
1 2 3 4 range
A 63
(-3)
P
71
(-3)
A
67.7
(-3)
A
11010.6
(3)
P
10948
B 72.4
(-3)
A
65
(-3)
A
32.3
(-3)
A
10014.8
(3)
P
9983
C 71.7
(-3)
A
62.6
(-3)
A
44.6
(-3)
A
10600.2
(3)
P
10556
avr 69
(-3)
66.2
(-3)
48.2
(-3)
10541.9
(3)
10494

Warning: fopen(./gnuplot/190719_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3741
1 2 3 4 5 6 range
A 581.6
(-2.3)
P
168.5
(-3)
P
195.8
(-2.9)
P
169
(-3)
P
158.8
(-3)
P
3796.7
(3)
P
3638
B 571.7
(-2.4)
P
360
(-2.7)
P
183.6
(-3)
P
177.3
(-3)
P
211.3
(-2.9)
P
3871.5
(3)
P
3694
C 420.5
(-2.4)
P
372.7
(-2.5)
P
142.9
(-3)
P
130.1
(-3)
P
163
(-2.9)
P
3171.9
(3)
P
3042
avr 524.6
(-2.4)
300.4
(-2.8)
174.1
(-3)
158.8
(-3)
177.7
(-3)
3613.4
(3)
3455
No Scale

Warning: fopen(./gnuplot/190719_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 2127
1 2 3 4 range
A 22.9
(-3)
P
15.4
(-3)
A
17.7
(-3)
A
1611.7
(3)
P
1596
B 23.1
(-3)
A
16
(-3)
A
7.5
(-3)
A
2134.2
(3)
P
2127
C 23.7
(-3)
A
18
(-3)
A
15.6
(-3)
A
1787.4
(3)
P
1772
avr 23.2
(-3)
16.5
(-3)
13.6
(-3)
1844.4
(3)
1831

Warning: fopen(./gnuplot/190719_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190719_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1417
1 2 3 4 5 6 range
A 107.2
(-2.6)
P
59.9
(-2.9)
P
42.6
(-3)
P
42.9
(-3)
P
47.9
(-3)
P
924.4
(3)
P
882
B 198.9
(-2.3)
P
119.8
(-2.7)
P
44.6
(-3)
P
47
(-3)
P
85.9
(-2.8)
P
1443.6
(3)
P
1399
C 155.9
(-2.2)
P
113.7
(-2.5)
P
36.4
(-2.9)
P
26.2
(-3)
P
52.7
(-2.8)
P
1061.8
(3)
P
1036
avr 154
(-2.4)
97.8
(-2.7)
41.2
(-3)
38.7
(-3)
62.2
(-2.9)
1143.3
(3)
1105
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 190719_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.11426
Sequence Type Exemplar sequence
Representative Public ID F10D2.6 NCBI
Target Description F10D2.6 /REP_DB=WormBase Gene ID /WP=CE09317 /TR=O16915 /GB=AAC48236.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=glucuronosyltransferase
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072410(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_072410 NCBI Caenorhabditis elegans F10D2.6 (glucuronosyltransferase) mRNA, complete cds. 11/11 None
F10D2.6 ENSEMBL cdna:known chromosome:CEL140:V:7144534:7147910:-1 gene:F10D2.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000033808 5/11 Cross Hyb Matching Probes None
GENEFINDER00000033821 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:7144649-7147897(-) 100.0 100.0
Public Domain and Genome References
Gene Title glucuronosyltransferase
Gene Symbol ugt-37
Ensembl F10D2.6
Entrez Gene 184293 Entrez gene
SwissProt O16915 EMBL-EBI
WormBase CE30747 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
8152 metabolism inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
16758 transferase activity, transferring hexosyl groups inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_504811 F10D2.6 [Caenorhabditis elegans] gb|AAC48236.2| Hypothetical protein F10D2.6 [Caenorhabditis elegans] 0.0
blast CAE72011 Hypothetical protein CBG19092 [Caenorhabditis briggsae] 0.0
blast NP_504820 F09G2.6 [Caenorhabditis elegans] gb|AAB71324.2| Hypothetical protein F09G2.6 [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR002213 EMBL-EBI UDP-glucoronosyl/UDP-glucosyl transferase 1.1E-12
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_504811.2 2 5-27,487-509
F10D2.6 2 5-27,487-509
Sequence
Target Sequence
>C. ELEGANS:190719_AT
ttcacttttcatcgtgggttccacaaactgctcttttagccgaccgccgtctaactgcat
ttttcactcacgcagggctgggaagtgttaacgaatgtccaatatttgctgatcaaatga
gaaatgccaaaatgttggcaagacataatggttcaattgagatctcgaagtatgatctgg
gaaatggagaaaaaattgaaaaaactttgagaactattctgtttgatgattcatatcgat
tgtcagctgagaaactagcacatcaactagcaaatcaacctgttaaacccaaggaattac
tgttaaggcatgctgaatttgcagcacagttcgggcgtctaccatctttggatccatact
ctcgacaactatcttttgttgaatattttttgatcgacgtggcagccatcttgatatttt
catctttgctgattgttgtcgtcttgttccaaatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TTCACTTTTCATCGTGGGTTCCACA 478 687 1100 Antisense
CCACAAACTGCTCTTTTAGCCGACC 407 275 1120 Antisense
TTTTCACTCACGCAGGGCTGGGAAG 99 675 1160 Antisense
GATTCATATCGATTGTCAGCTGAGA 388 431 1327 Antisense
GCACATCAACTAGCAAATCAACCTG 20 315 1357 Antisense
AATTTGCAGCACAGTTCGGGCGTCT 401 171 1415 Antisense
ATCCATACTCTCGACAACTATCTTT 53 41 1451 Antisense
TTTTTGATCGACGTGGCAGCCATCT 603 673 1486 Antisense
GCAGCCATCTTGATATTTTCATCTT 328 315 1501 Antisense
ATCTTTGCTGATTGTTGTCGTCTTG 664 31 1521 Antisense
GATTGTTGTCGTCTTGTTCCAAATT 73 435 1530 Antisense
Sequence Source Affymetrix Proprietary Database