[Home] | [Total List]

[190597_s_at] extracellular protein

Description H10D18.4 /REP_DB=WormBase Gene ID /WP=CE20952 /TR=Q9N5N4 /GB=AAF39876.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=extracellular protein
Cluster 6grp_total > 88      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/190597_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 3489
1 2 3 4 range
A 92
(-2.8)
A
50.5
(-2.9)
A
13.7
(-3)
A
3111.8
(3)
P
3098
B 71.7
(-2.9)
A
60.8
(-2.9)
A
7.5
(-3)
A
3496.2
(3)
P
3489
C 91
(-2.9)
M
50.4
(-3)
A
30.2
(-3)
A
2950
(3)
P
2920
avr 84.9
(-2.9)
53.9
(-2.9)
17.1
(-3)
3186
(3)
3169

Warning: fopen(./gnuplot/190597_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 23673
1 2 3 4 5 6 range
A 78.3
(-3)
A
15.6
(-3)
A
45.7
(-3)
A
1294.3
(-2.7)
P
11302.5
(-0.1)
P
23678.2
(3)
P
23663
B 6.7
(-3)
A
19.8
(-3)
A
53.4
(-3)
A
1046.7
(-2.6)
P
11657.2
(1.1)
P
17112.2
(3)
P
17106
C 42.7
(-3)
A
17
(-3)
A
5.2
(-3)
A
925.6
(-2.7)
P
12541.1
(1.4)
P
17251.9
(3)
P
17247
avr 42.6
(-3)
17.5
(-3)
34.8
(-3)
1088.9
(-2.7)
11833.6
(0.7)
19347.4
(3)
19330
No Scale

Warning: fopen(./gnuplot/190597_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 743
1 2 3 4 range
A 33.5
(-2.6)
A
11
(-2.9)
A
3.6
(-3)
A
455.5
(3)
P
452
B 22.9
(-2.8)
A
15
(-2.9)
A
1.7
(-3)
A
745
(3)
P
743
C 30.1
(-2.8)
M
14.5
(-3)
A
10.5
(-3)
A
497.4
(3)
P
487
avr 28.8
(-2.7)
13.5
(-2.9)
5.3
(-3)
566
(3)
561

Warning: fopen(./gnuplot/190597_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190597_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 6380
1 2 3 4 5 6 range
A 14.4
(-3)
A
5.6
(-3)
A
9.9
(-3)
A
328.3
(-2.7)
P
3410.6
(0.5)
P
5764.9
(3)
P
5759
B 2.3
(-3)
A
6.6
(-3)
A
13
(-3)
A
277.2
(-2.7)
P
4736.2
(1.5)
P
6381.1
(3)
P
6379
C 15.8
(-3)
A
5.2
(-3)
A
1.3
(-3)
A
186.1
(-2.8)
P
4058.1
(1.2)
P
5775.2
(3)
P
5774
avr 10.8
(-3)
5.8
(-3)
8.1
(-3)
263.9
(-2.7)
4068.3
(1.1)
5973.7
(3)
5968
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 190597_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15093
Sequence Type Exemplar sequence
Representative Public ID H10D18.4 NCBI
Target Description H10D18.4 /REP_DB=WormBase Gene ID /WP=CE20952 /TR=Q9N5N4 /GB=AAF39876.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=extracellular protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071654(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071654 NCBI Caenorhabditis elegans H10D18.4 (H10D18.4) mRNA, complete cds. 11/11 None
SNAP00000043933 ENSEMBL cdna:SNAP chromosome:CEL140:V:3810670:3811514:-1 11/11 None
GENEFINDER00000043946 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:3810670:3811448:-1 11/11 None
H10D18.4 ENSEMBL cdna:known chromosome:CEL140:V:3810662:3811448:-1 gene:H10D18.4 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:3810669-3811448(-) 100.0 100.0
Public Domain and Genome References
Gene Title extracellular protein
Ensembl H10D18.4
Entrez Gene 178798 Entrez gene
SwissProt Q9N5N4 EMBL-EBI
WormBase CE20952 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5576 extracellular region inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF39876 Hypothetical protein H10D18.4 [Caenorhabditis elegans] ref|NP_504055.1| H10D18.4 [Caenorhabditis elegans] 1.0E-113
blast AAF39874 Hypothetical protein H10D18.2 [Caenorhabditis elegans] ref|NP_504056.1| H10D18.2 [Caenorhabditis elegans] 6.0E-85
blast AAF39874 Hypothetical protein H10D18.2 [Caenorhabditis elegans] ref|NP_504056.1| H10D18.2 [Caenorhabditis elegans] 7.0E-85
blast CAE58120 Hypothetical protein CBG01207 [Caenorhabditis briggsae] 7.0E-70
Protein Domains
Database ID Description E-Value
Pfam IPR001283 EMBL-EBI Allergen V5/Tpx-1 related 7.0E-64
Pfam IPR001283 EMBL-EBI Allergen V5/Tpx-1 related 7.0E-64
Sequence
Target Sequence
>C. ELEGANS:190597_S_AT
atgaaattcgctctttgtcttcttgccatctttggatgcgccactgctcaattcagctca
actgctcagggccagattgtggatgctcataacaagctgagatccgcaatcgctcaggga
agttacgtcgcagcgggaacccaagaaccatcggcttcgaacatgagaaaaattgtttgg
gatgaaacagtggcagctgccgctcaagagtatgccgaaggatgtccagatgatcattct
ggaactagttatggagagaacctctactggtcctggtcttcgtcggctccaagcagtctt
gacaagtttggagttgctgcatcaaattcctgggaaagcgagttccaaaagtacggatgg
acatccacttttctcgatgaagccggttttgctactggaatcggacatgctactcaaatg
gcttgggctgaaactagcaagatcggatgcggaattaaaaattgtggaaaagatgcgaac
aagaaaaacatgtacaaagttgcagtggtctgccaatacgattccgccggtaacatgatg
gactcggacatttaccaacagggagaaacgtgttctgcatgctcggaagat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGAAATTCGCTCTTTGTCTTCTTG 315 45 13 Antisense
CCACTGCTCAATTCAGCTCAACTGC 333 275 53 Antisense
GCTCAACTGCTCAGGGCCAGATTGT 577 301 68 Antisense
GAGATCCGCAATCGCTCAGGGAAGT 314 393 111 Antisense
GAAGTTACGTCGCAGCGGGAACCCA 704 137 131 Antisense
ACCCAAGAACCATCGGCTTCGAACA 664 89 151 Antisense
GGCAGCTGCCGCTCAAGAGTATGCC 42 537 204 Antisense
ACGGATGGACATCCACTTTTCTCGA 50 93 365 Antisense
GAAGCCGGTTTTGCTACTGGAATCG 102 339 391 Antisense
GCAGTGGTCTGCCAATACGATTCCG 567 311 514 Antisense
AACGTGTTCTGCATGCTCGGAAGAT 648 143 579 Antisense
Sequence Source Affymetrix Proprietary Database