[Home] | [Total List]

[190317_at] Zinc finger, C2H2 type

Description F10B5.3 /REP_DB=WormBase Gene ID /WP=CE01545 /TR=Q09534 /GB=CAA88310.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=Zinc finger, C2H2 type
Cluster 6grp_total > 96      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/190317_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 2170
1 2 3 4 range
A 79.7
(-2.8)
A
8.6
(-3)
A
5.7
(-3)
A
1920.9
(3)
P
1915
B 78.5
(-2.8)
A
73.5
(-2.8)
A
2.9
(-3)
A
2173
(3)
P
2170
C 46.2
(-2.9)
A
60
(-2.8)
A
6.5
(-3)
A
2011.6
(3)
P
2005
avr 68.1
(-2.8)
47.4
(-2.9)
5
(-3)
2035.2
(3)
2030

Warning: fopen(./gnuplot/190317_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1085
1 2 3 4 5 6 range
A 66.9
(-2.6)
A
28.8
(-2.8)
A
2.9
(-3)
A
324.6
(-0.8)
M
769.3
(2.2)
P
886.7
(3)
P
884
B 22.3
(-2.9)
A
59.6
(-2.7)
A
3.4
(-3)
A
361.7
(-1)
P
869.9
(1.8)
P
1087.9
(3)
P
1085
C 55.2
(-2.7)
A
11.6
(-3)
A
6.3
(-3)
A
359.9
(-0.9)
P
681.1
(1)
P
1027.3
(3)
P
1021
avr 48.1
(-2.7)
33.3
(-2.8)
4.2
(-3)
348.7
(-0.9)
773.4
(1.6)
1000.6
(3)
996
No Scale

Warning: fopen(./gnuplot/190317_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 462
1 2 3 4 range
A 29
(-2.4)
A
1.9
(-3)
A
1.5
(-3)
A
281.2
(3)
P
280
B 25
(-2.7)
A
18.1
(-2.8)
A
0.7
(-3)
A
463.1
(3)
P
462
C 15.3
(-2.8)
A
17.3
(-2.7)
A
2.3
(-3)
A
339.2
(3)
P
337
avr 23.1
(-2.6)
12.4
(-2.8)
1.5
(-3)
361.2
(3)
360

Warning: fopen(./gnuplot/190317_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190317_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 405
1 2 3 4 5 6 range
A 12.3
(-2.7)
A
10.2
(-2.8)
A
0.6
(-3)
A
82.3
(-0.9)
M
232.1
(3)
P
215.9
(2.6)
P
232
B 7.8
(-2.9)
A
19.8
(-2.7)
A
0.8
(-3)
A
95.8
(-1.6)
P
353.4
(2.2)
P
405.7
(3)
P
405
C 20.4
(-2.7)
A
3.5
(-3)
A
1.6
(-3)
A
72.4
(-1.8)
P
220.4
(0.8)
P
343.9
(3)
P
342
avr 13.5
(-2.8)
11.2
(-2.8)
1
(-3)
83.5
(-1.5)
268.6
(2)
321.8
(3)
321
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 190317_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.3577
Sequence Type Exemplar sequence
Representative Public ID F10B5.3 NCBI
Target Description F10B5.3 /REP_DB=WormBase Gene ID /WP=CE01545 /TR=Q09534 /GB=CAA88310.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=Zinc finger, C2H2 type
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_063308(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_063308 NCBI Caenorhabditis elegans F10B5.3 (F10B5.3) mRNA, complete cds. 11/11 None
GENEFINDER00000014827 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:8147284:8149936:-1 11/11 None
F10B5.3.2 ENSEMBL cdna:known chromosome:CEL140:II:8146716:8149951:-1 gene:F10B5.3 11/11 None
F10B5.3.1 ENSEMBL cdna:known chromosome:CEL140:II:8147124:8149951:-1 gene:F10B5.3 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000014814 6/11 Cross Hyb Matching Probes None
SNAP00000014815 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:8147280-8149933(-) 100.0 100.0
Public Domain and Genome References
Gene Title Zinc finger, C2H2 type
Ensembl F10B5.3
Entrez Gene 184285 Entrez gene
SwissProt Q09534 EMBL-EBI
WormBase CE01545 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3676 nucleic acid binding inferred from electronic annotation QuickGO AmiGO
8270 zinc ion binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA88310 Hypothetical protein F10B5.3 [Caenorhabditis elegans] ref|NP_495709.1| F10B5.3 [Caenorhabditis elegans] 0.0
blast CAE57731 Hypothetical protein CBG00742 [Caenorhabditis briggsae] 1.0E-178
blast CAE57731 Hypothetical protein CBG00742 [Caenorhabditis briggsae] 1.0E-174
blast CAE59557 Hypothetical protein CBG02954 [Caenorhabditis briggsae] 3.0E-56
Sequence
Target Sequence
>C. ELEGANS:190317_AT
atggatgtaacttttcaactcgtgaagcaagatatattcattttcataaatattatcgtc
atcacattcctcttccggaaaatattgatttaggttctcgaaagtgtccattctgtagac
acgtctcaaaaagtcctgcaatgttggaaaaacatattgctcgacacgaaaccgatggga
caagtggtggcacaccaggcgcattgaaaagagcacagagcaaaaagaaaattgttccaa
caatgactactgacgtcattgatccgaatgtttcctcaatctttgctccaacaaatccag
ctggaaatattccgattcaatgctcattgtgcccgttctccactcactccacagatcttc
tgttcattcatttggcaatgcagcatgctcaggaacttgcacaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGGATGTAACTTTTCAACTCGTGA 454 51 875 Antisense
ATATTATCGTCATCACATTCCTCTT 562 19 924 Antisense
GGTTCTCGAAAGTGTCCATTCTGTA 671 503 967 Antisense
ACACGTCTCAAAAAGTCCTGCAATG 674 109 993 Antisense
GTGGCACACCAGGCGCATTGAAAAG 596 491 1061 Antisense
GACTACTGACGTCATTGATCCGAAT 65 373 1119 Antisense
TCCGAATGTTTCCTCAATCTTTGCT 317 595 1137 Antisense
ATCTTTGCTCCAACAAATCCAGCTG 598 31 1153 Antisense
GATTCAATGCTCATTGTGCCCGTTC 176 431 1188 Antisense
GATCTTCTGTTCATTCATTTGGCAA 246 419 1228 Antisense
GCAGCATGCTCAGGAACTTGCACAA 44 313 1254 Antisense
Sequence Source Affymetrix Proprietary Database