[Home] | [Total List]

[190109_at] DM DNA binding domain

Description C34D1.2 /REP_DB=WormBase Gene ID /WP=CE08570 /TR=Q18435 /GB=CAB01490.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=DM DNA binding domain
Cluster 6grp_total > 83      4grp_total > 16      6grp_total_sub > Hat      6grp_rule_based > S5      

Scale

Warning: fopen(./gnuplot/190109_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 70
1 2 3 4 range
A 3.1
(-3)
A
17.4
(-1.6)
A
35.5
(0.2)
A
64.4
(3)
A
61
B 13
(-1)
A
9.2
(-1.8)
A
32.3
(3)
A
3.2
(-3)
A
29
C 2.6
(-3)
A
6.9
(-2.6)
A
10.5
(-2.3)
A
72.9
(3)
P
70
avr 6.2
(-3)
11.2
(-2.3)
26.1
(-0.1)
46.8
(3)
41

Warning: fopen(./gnuplot/190109_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 615
1 2 3 4 5 6 range
A 26.2
(-2.8)
A
4.7
(-3)
A
80.8
(-2.3)
P
613.9
(3)
P
423.4
(1.1)
P
104.1
(-2)
P
609
B 3.2
(-3)
A
2.9
(-3)
A
90.7
(-1.9)
P
480.2
(3)
P
457.5
(2.7)
P
105.2
(-1.7)
P
477
C 3
(-3)
A
5.1
(-3)
A
106.6
(-2)
P
378.4
(0.7)
P
617.9
(3)
P
130.5
(-1.8)
P
615
avr 10.8
(-2.9)
4.2
(-3)
92.7
(-1.9)
490.8
(2.9)
499.6
(3)
113.3
(-1.7)
495
No Scale

Warning: fopen(./gnuplot/190109_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 12
1 2 3 4 range
A 1.1
(-3)
A
3.8
(-1)
A
9.3
(2.9)
A
9.4
(3)
A
8
B 4.1
(-0)
A
2.3
(-1.6)
A
7.5
(3)
A
0.7
(-3)
A
7
C 0.9
(-3)
A
2
(-2.4)
A
3.6
(-1.6)
A
12.3
(3)
P
11
avr 2
(-3)
2.7
(-2.2)
6.8
(2.2)
7.5
(3)
6

Warning: fopen(./gnuplot/190109_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/190109_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 199
1 2 3 4 5 6 range
A 4.8
(-2.9)
A
1.7
(-3)
A
17.6
(-2.4)
P
155.7
(3)
P
127.8
(1.9)
P
25.4
(-2.1)
P
154
B 1.1
(-3)
A
1
(-3)
A
22
(-2.3)
P
127.2
(1.1)
P
185.9
(3)
P
39.2
(-1.8)
P
185
C 1.1
(-3)
A
1.5
(-3)
A
27.1
(-2.2)
P
76.1
(-0.7)
P
200
(3)
P
43.7
(-1.7)
P
199
avr 2.3
(-3)
1.4
(-3)
22.2
(-2.3)
119.7
(1.2)
171.2
(3)
36.1
(-1.8)
170
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 190109_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12755
Sequence Type Exemplar sequence
Representative Public ID C34D1.2 NCBI
Target Description C34D1.2 /REP_DB=WormBase Gene ID /WP=CE08570 /TR=Q18435 /GB=CAB01490.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=DM DNA binding domain
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073888(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_073888 NCBI Caenorhabditis elegans C34D1.2 (C34D1.2) mRNA, complete cds. 11/11 None
SNAP00000025074 ENSEMBL cdna:SNAP chromosome:CEL140:V:13238762:13239195:-1 11/11 None
GENEFINDER00000025083 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:13238583:13239195:-1 11/11 None
C34D1.2 ENSEMBL cdna:known chromosome:CEL140:V:13238762:13239195:-1 gene:C34D1.2 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:13238761-13239195(-) 100.0 100.0
Public Domain and Genome References
Gene Title DM DNA binding domain
Ensembl C34D1.2
Entrez Gene 183203 Entrez gene
SwissProt Q18435 EMBL-EBI
WormBase CE08570 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6355 regulation of transcription, DNA-dependent inferred from electronic annotation QuickGO AmiGO
7548 sex differentiation inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
3700 transcription factor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB01490 Hypothetical protein C34D1.2 [Caenorhabditis elegans] ref|NP_506289.1| C34D1.2 [Caenorhabditis elegans] 2.0E-64
blast CAB01490 Hypothetical protein C34D1.2 [Caenorhabditis elegans] ref|NP_506289.1| C34D1.2 [Caenorhabditis elegans] 1.0E-63
blast CAE64645 Hypothetical protein CBG09411 [Caenorhabditis briggsae] 1.0E-36
blast CAE64645 Hypothetical protein CBG09411 [Caenorhabditis briggsae] 6.0E-36
blast CAE61740 Hypothetical protein CBG05691 [Caenorhabditis briggsae] 6.0E-11
blast CAE61740 Hypothetical protein CBG05691 [Caenorhabditis briggsae] 7.0E-11
Protein Domains
Database ID Description E-Value
Pfam IPR001275 EMBL-EBI DM DNA-binding 3.9E-27
Sequence
Target Sequence
>C. ELEGANS:190109_AT
atggttgctgatgtactccgacagtcagttctcgtgcctatttccatgtatccacagtat
ccagtgcctaggaggtacacaacatctgttttcaaggagtatcaaaagaagaagaagatt
tattattgccaaagatgtttaaaccatgatgttccaaggcctaggaaaaatcacaaatgt
gagtgtccatacgcagattgcacttgtga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGGTTGCTGATGTACTCCGACAGT 668 51 13 Antisense
ATGTACTCCGACAGTCAGTTCTCGT 611 47 23 Antisense
TCGTGCCTATTTCCATGTATCCACA 627 605 44 Antisense
ATGTATCCACAGTATCCAGTGCCTA 388 47 58 Antisense
GTATCCAGTGCCTAGGAGGTACACA 435 455 69 Antisense
TAGGAGGTACACAACATCTGTTTTC 410 651 81 Antisense
ACAACATCTGTTTTCAAGGAGTATC 126 111 91 Antisense
ATTATTGCCAAAGATGTTTAAACCA 421 11 134 Antisense
AAACCATGATGTTCCAAGGCCTAGG 616 123 153 Antisense
TGTGAGTGTCCATACGCAGATTGCA 511 555 190 Antisense
GTCCATACGCAGATTGCACTTGTGA 191 477 197 Antisense
Sequence Source Affymetrix Proprietary Database