[Home] | [Total List]

[189556_at] cytochrome P450

Description C45H4.17 /REP_DB=WormBase Gene ID /WP=CE25818 /TR=O44706 /GB=AAC25881.2 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster 6grp_total > 96      4grp_total > 0      6grp_cgc > 68      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/189556_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 52
1 2 3 4 range
A 5.8
(-3)
A
8.9
(-2)
A
25
(3)
A
12.3
(-1)
A
19
B 16.3
(-0.2)
A
1.3
(-3)
A
22.1
(0.9)
A
33.3
(3)
A
32
C 19.6
(-0.9)
A
2.2
(-3)
A
13.6
(-1.7)
A
53
(3)
P
51
avr 13.9
(-1)
4.1
(-3)
20.2
(0.4)
32.9
(3)
29

Warning: fopen(./gnuplot/189556_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 198
1 2 3 4 5 6 range
A 3.8
(-3)
A
12.8
(-2.4)
A
21.1
(-1.8)
A
33.4
(-1)
P
93.5
(3)
P
88.6
(2.7)
P
90
B 14.2
(-2.3)
A
3.7
(-3)
A
26.4
(-1.5)
A
66.7
(1.2)
M
94.4
(3)
P
94
(3)
P
91
C 3.6
(-3)
A
35.5
(-2)
A
30.9
(-2.2)
P
41.9
(-1.8)
A
70
(-1)
P
201.9
(3)
P
198
avr 7.2
(-3)
17.3
(-2.5)
26.1
(-2.1)
47.3
(-1)
86
(0.9)
128.2
(3)
121
No Scale

Warning: fopen(./gnuplot/189556_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 9
1 2 3 4 range
A 2.1
(-2.6)
A
1.9
(-2.9)
A
6.5
(3)
A
1.8
(-3)
A
5
B 5.2
(1.3)
A
0.3
(-3)
A
5.1
(1.2)
A
7.1
(3)
A
7
C 6.5
(1.3)
A
0.6
(-3)
A
4.7
(-0)
A
8.9
(3)
P
8
avr 4.6
(1.4)
0.9
(-3)
5.4
(2.4)
5.9
(3)
5

Warning: fopen(./gnuplot/189556_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189556_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 67
1 2 3 4 5 6 range
A 0.7
(-3)
A
4.5
(-2.2)
A
4.6
(-2.1)
A
8.5
(-1.3)
P
28.2
(3)
P
21.6
(1.6)
P
28
B 4.9
(-2.4)
A
1.2
(-3)
A
6.4
(-2.2)
A
17.7
(-0.3)
M
38.3
(3)
P
35.1
(2.5)
P
37
C 1.3
(-3)
A
10.8
(-2.1)
A
7.9
(-2.4)
P
8.4
(-2.4)
A
22.7
(-1.1)
P
67.6
(3)
P
66
avr 2.3
(-3)
5.5
(-2.5)
6.3
(-2.4)
11.5
(-1.6)
29.7
(1.2)
41.4
(3)
39
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 189556_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15084
Sequence Type Exemplar sequence
Representative Public ID C45H4.17 NCBI
Target Description C45H4.17 /REP_DB=WormBase Gene ID /WP=CE25818 /TR=O44706 /GB=AAC25881.2 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071193(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071193 NCBI Caenorhabditis elegans CYtochrome P450 family member (cyp-33C2) (cyp-33C2) mRNA, complete cds. 11/11 None
C45H4.17 ENSEMBL cdna:known chromosome:CEL140:V:2183349:2186363:1 gene:C45H4.17 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000028124 4/11 Cross Hyb Matching Probes None
GENEFINDER00000028138 4/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:2183348-2186363(+) 100.0 100.0
Public Domain and Genome References
Gene Title cytochrome P450
Gene Symbol cyp-33C2
Ensembl C45H4.17
Entrez Gene 178695 Entrez gene
SwissProt O44706 EMBL-EBI
WormBase CE25818 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:17018_S_AT cytochrome P450 family protein at
ATH1-121501:254687_AT cytochrome P450 family protein at
CHICKEN:GGAAFFX.21843.1.S1_S_AT cytochrome P450 2H1 gga
CHICKEN:GGA.14711.1.S1_AT cytochrome P450 2H1 gga
HG-U95AV2:38548_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-U133_PLUS_2:208147_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-U133A:208147_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-FOCUS:208147_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-U133A_2:208147_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
U133_X3P:G13787186_3P_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-U133_PLUS_2:219903_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-U133A:219903_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-U133A_2:219903_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
HG-FOCUS:219903_S_AT cytochrome P450, family 2, subfamily C, polypeptide 8 hs
MOE430A:1429994_S_AT cytochrome P450, family 2, subfamily c, polypeptide 65 mm
MOUSE430_2:1429994_S_AT cytochrome P450, family 2, subfamily c, polypeptide 65 mm
MOUSE430A_2:1429994_S_AT cytochrome P450, family 2, subfamily c, polypeptide 65 mm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4497 monooxygenase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAC25881 Cytochrome p450 family protein 33C2 [Caenorhabditis elegans] ref|NP_503594.1| CYtochrome P450 family member (cyp-33C2) [Caenorhabditis elegans] 0.0
blast AAC25869 Cytochrome p450 family protein 33C1 [Caenorhabditis elegans] ref|NP_503592.1| CYtochrome P450 family member (cyp-33C1) [Caenorhabditis elegans] 0.0
blast CAE74164 Hypothetical protein CBG21837 [Caenorhabditis briggsae] emb|CAE74152.1| Hypothetical protein CBG21823 [Caenorhabditis briggsae] 0.0
Protein Families
Method ID Description E-Value
p450 CP1B_HUMAN Animalia; CYP1B1; hum; CP1B_HUMAN; Homo sapiens; Q16678 1.0E-156
Protein Domains
Database ID Description E-Value
Pfam IPR001128 EMBL-EBI Cytochrome P450 2.8E-116
Sequence
Target Sequence
>C. ELEGANS:189556_AT
atgtccaactttcaaatgtttgcatggacctttggttcgcgggtcttaacactacaacta
atacaattacatgggcaatcagctacattttgcatcatccagaggttcaggacaaggttc
atgaggaaatggacaaagtgattggaagtgatagacttatcaccacagctgataaaaatg
atctaccgtacttcaacgcgtttatcaatgaagcgcaacgtggaatcaacattgtccctc
tgaacctccagcacgcaaccacccgtgatactgtaataaatgggttcaaaatcccgaaag
ggactggagtggtcgcccagattagtactgttatgaataatgaggaagtgtttccggacc
cgcacactttcaatccagacagatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGTCCAACTTTCAAATGTTTGCAT 236 49 881 Antisense
TGCATGGACCTTTGGTTCGCGGGTC 658 567 901 Antisense
TTCGCGGGTCTTAACACTACAACTA 531 697 916 Antisense
CCAGAGGTTCAGGACAAGGTTCATG 422 267 979 Antisense
ATAAAAATGATCTACCGTACTTCAA 578 23 1052 Antisense
CGTACTTCAACGCGTTTATCAATGA 604 213 1067 Antisense
CAATGAAGCGCAACGTGGAATCAAC 2 183 1086 Antisense
TGGAATCAACATTGTCCCTCTGAAC 344 547 1101 Antisense
AAGGGACTGGAGTGGTCGCCCAGAT 9 159 1178 Antisense
TAATGAGGAAGTGTTTCCGGACCCG 600 633 1218 Antisense
CGCACACTTTCAATCCAGACAGATT 186 255 1241 Antisense
Sequence Source Affymetrix Proprietary Database