[Home] | [Total List]

[189366_at] cytochrome P450

Description K07C6.4 /REP_DB=WormBase Gene ID /WP=CE17175 /TR=O44650 /GB=AAB94247.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster 6grp_highest_10_10 > 37      6grp_high1_10_10 > 73      6grp_highest_nonorm > 53      6grp_total > 73      4grp_total > 02      6grp_highest_sub > 03_04      6grp_cgc > 76      6grp_high1_sub > 03_04      6grp_cgc_sub > 03_04      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/189366_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 590
1 2 3 4 range
A 1.8
(-3)
A
3.9
(-3)
A
2.5
(-3)
A
591.7
(3)
P
590
B 4.4
(-3)
A
2.2
(-3)
A
1.9
(-3)
A
590
(3)
P
588
C 3.7
(-3)
A
3.8
(-3)
A
2
(-3)
A
491.4
(3)
P
489
avr 3.3
(-3)
3.3
(-3)
2.1
(-3)
557.7
(3)
556

Warning: fopen(./gnuplot/189366_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1027
1 2 3 4 5 6 range
A 159.8
(-3)
P
276.5
(-2.3)
P
1186.4
(3)
P
1130.1
(2.7)
P
599.2
(-0.4)
P
433.1
(-1.4)
P
1027
B 163.2
(-3)
P
240.1
(-2.5)
P
1148.2
(3)
P
943.2
(1.8)
P
716
(0.4)
P
502.2
(-0.9)
P
985
C 203
(-3)
P
251.6
(-2.7)
P
1104
(3)
P
1051.6
(2.7)
P
583.8
(-0.5)
P
510.8
(-1)
P
901
avr 175.3
(-3)
256.1
(-2.5)
1146.2
(3)
1041.6
(2.4)
633
(-0.2)
482
(-1.1)
971
No Scale

Warning: fopen(./gnuplot/189366_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 125
1 2 3 4 range
A 0.6
(-3)
A
0.8
(-3)
A
0.7
(-3)
A
86.6
(3)
P
86
B 1.4
(-3)
A
0.6
(-3)
A
0.4
(-3)
A
125.7
(3)
P
125
C 1.2
(-3)
A
1.1
(-3)
A
0.7
(-3)
A
82.9
(3)
P
82
avr 1.1
(-3)
0.8
(-3)
0.6
(-3)
98.4
(3)
98

Warning: fopen(./gnuplot/189366_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189366_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 261
1 2 3 4 5 6 range
A 29.5
(-3)
P
98.3
(-1.4)
P
258.4
(2.3)
P
286.6
(3)
P
180.8
(0.5)
P
105.5
(-1.2)
P
257
B 56.8
(-3)
P
79.9
(-2.4)
P
278.8
(2.7)
P
249.8
(1.9)
P
290.9
(3)
P
187.3
(0.3)
P
234
C 75.2
(-3)
P
76.8
(-3)
P
281
(3)
P
211.5
(1)
P
188.9
(0.3)
P
171
(-0.2)
P
206
avr 53.8
(-3)
85
(-2.1)
272.7
(3)
249.3
(2.4)
220.2
(1.6)
154.6
(-0.2)
219
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 189366_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15043
Sequence Type Exemplar sequence
Representative Public ID K07C6.4 NCBI
Target Description K07C6.4 /REP_DB=WormBase Gene ID /WP=CE17175 /TR=O44650 /GB=AAB94247.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071692(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071692 NCBI Caenorhabditis elegans CYtochrome P450 family member (cyp-35B1) (cyp-35B1) mRNA, complete cds. 11/11 None
SNAP00000025767 ENSEMBL cdna:SNAP chromosome:CEL140:V:3938940:3940997:1 11/11 None
GENEFINDER00000025778 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:3938940:3940997:1 11/11 None
K07C6.4 ENSEMBL cdna:known chromosome:CEL140:V:3938940:3940997:1 gene:K07C6.4 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:3938939-3940997(+) 99.64 100.0
Public Domain and Genome References
Gene Title cytochrome P450
Gene Symbol cyp-35B1
Ensembl K07C6.4
Entrez Gene 178803 Entrez gene
SwissProt O44650 EMBL-EBI
WormBase CE17175 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:258962_AT cytochrome P450, putative at
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4497 monooxygenase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB94247 Cytochrome p450 family protein 35B1 [Caenorhabditis elegans] ref|NP_504093.1| CYtochrome P450 family member (cyp-35B1) [Caenorhabditis elegans] 0.0
blast AAB94246 Cytochrome p450 family protein 35B2 [Caenorhabditis elegans] ref|NP_504094.1| CYtochrome P450 family member (cyp-35B2) [Caenorhabditis elegans] 0.0
blast CAE58284 Hypothetical protein CBG01391 [Caenorhabditis briggsae] 0.0
Protein Families
Method ID Description E-Value
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-151
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-144
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-143
Protein Domains
Database ID Description E-Value
Pfam IPR001128 EMBL-EBI Cytochrome P450 9.0E-26
Pfam IPR001128 EMBL-EBI Cytochrome P450 3.7E-64
Pfam IPR001128 EMBL-EBI Cytochrome P450 4.4E-93
Pfam IPR001128 EMBL-EBI Cytochrome P450 4.0E-83
Sequence
Target Sequence
>C. ELEGANS:189366_AT
tggagatctctggttagctggtcaagataccacttcaacgactttggtcgcaggattcaa
tcatcttgttaaaaatccagaaattgttagaaaatgcagggaggaaattctgaggatcac
agaaaacgggtcacgtccacttcagctaaaagacagagctgaatctcattacctcaacgc
tacaattgcggaaatccaacgccacgcttcaattttaaatgttaacttttggaggcttgt
tcatgagccgacaactgtacagggacatccagtggactcaggttcagtgatttgtgctca
acttggagctcttcatgtaaacgatgatttattcaaaaatcccgacaagttctacccgga
aagatttattgaaaacgagcaacttttaagtcaaataataccttttggaattggaaaacg
atcgtgtgttggagaaaatattgcaaaatcagagctatacttgatgattggaaatcttat
cctgcgatatgacattaagccacatggttctgaaccttcaacagaagataaacttccgta
tagcgctg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGGAGATCTCTGGTTAGCTGGTCAA 483 549 1065 Antisense
GGTCAAGATACCACTTCAACGACTT 126 475 1084 Antisense
ACGACTTTGGTCGCAGGATTCAATC 597 45 1102 Antisense
CACAGAAAACGGGTCACGTCCACTT 685 187 1182 Antisense
TCATGAGCCGACAACTGTACAGGGA 88 623 1305 Antisense
TGTACAGGGACATCCAGTGGACTCA 335 559 1320 Antisense
GACTCAGGTTCAGTGATTTGTGCTC 63 375 1339 Antisense
GCTCAACTTGGAGCTCTTCATGTAA 697 301 1360 Antisense
GGAAATCTTATCCTGCGATATGACA 479 527 1534 Antisense
ATTAAGCCACATGGTTCTGAACCTT 565 3 1558 Antisense
GAAGATAAACTTCCGTATAGCGCTG 3 337 1588 Antisense
Sequence Source Affymetrix Proprietary Database