[Home] | [Total List]

[189362_at] Yeast GNS1 like

Description F56H11.3 /REP_DB=WormBase Gene ID /WP=CE16144 /TR=Q20904 /GB=CAA92960.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=Yeast GNS1 like
Cluster 6grp_total > 89      4grp_total > 24      6grp_cgc > 59      6grp_cgc_sub > Da      

Scale

Warning: fopen(./gnuplot/189362_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 76
1 2 3 4 range
A 4
(-2.9)
A
3.1
(-3)
A
40.4
(3)
A
38.2
(2.6)
A
37
B 6.1
(-2.8)
A
18.5
(-1)
A
46
(3)
A
4.6
(-3)
A
41
C 2.6
(-3)
A
5
(-2.8)
A
6.6
(-2.7)
A
78.5
(3)
A
76
avr 4.2
(-3)
8.9
(-2.2)
31
(1.4)
40.4
(3)
36

Warning: fopen(./gnuplot/189362_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 105
1 2 3 4 5 6 range
A 52.5
(-0.2)
A
3.2
(-3)
A
2.6
(-3)
A
5.6
(-2.8)
A
68
(0.7)
A
107.8
(3)
A
105
B 7.6
(-2.9)
A
5.7
(-3)
A
5.7
(-3)
A
17.6
(-2.1)
A
76.2
(2.2)
A
87.6
(3)
P
82
C 26.6
(-1.7)
A
45.1
(-0)
A
37.3
(-0.8)
A
13
(-3)
A
64.5
(1.8)
A
77.9
(3)
P
65
avr 28.9
(-1.7)
18
(-2.6)
15.2
(-2.8)
12.1
(-3)
69.6
(1.4)
91.1
(3)
79
No Scale

Warning: fopen(./gnuplot/189362_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 13
1 2 3 4 range
A 1.5
(-2.5)
A
0.7
(-3)
A
10.6
(3)
A
5.6
(-0)
A
10
B 2
(-2.4)
A
4.6
(-0.8)
A
10.7
(3)
A
1
(-3)
A
10
C 0.9
(-3)
A
1.4
(-2.8)
A
2.3
(-2.3)
A
13.2
(3)
A
12
avr 1.5
(-3)
2.2
(-2.3)
7.9
(3)
6.6
(1.8)
6

Warning: fopen(./gnuplot/189362_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189362_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 32
1 2 3 4 5 6 range
A 9.7
(-0.9)
A
1.1
(-2.9)
A
0.6
(-3)
A
1.4
(-2.8)
A
20.5
(1.7)
A
26.2
(3)
A
26
B 2.7
(-2.8)
A
1.9
(-2.9)
A
1.4
(-3)
A
4.7
(-2.4)
A
31
(2.7)
A
32.7
(3)
P
31
C 9.8
(-1.2)
A
13.8
(-0.1)
A
9.5
(-1.2)
A
2.6
(-3)
A
20.9
(1.7)
A
26.1
(3)
P
24
avr 7.4
(-1.9)
5.6
(-2.4)
3.8
(-2.8)
2.9
(-3)
24.1
(2)
28.3
(3)
25
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 189362_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.9775
Sequence Type Exemplar sequence
Representative Public ID F56H11.3 NCBI
Target Description F56H11.3 /REP_DB=WormBase Gene ID /WP=CE16144 /TR=Q20904 /GB=CAA92960.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=Yeast GNS1 like
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069290(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069290 NCBI Caenorhabditis elegans fatty acid ELOngation family member (elo-7) (elo-7) mRNA, complete cds. 10/11 None
SNAP00000040069 ENSEMBL cdna:SNAP chromosome:CEL140:IV:9530266:9531030:1 11/11 None
GENEFINDER00000040075 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:9530266:9531204:1 11/11 None
F56H11.3 ENSEMBL cdna:known chromosome:CEL140:IV:9529964:9531204:1 gene:F56H11.3 10/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:9529969-9531109(+) 100.0 100.0
Public Domain and Genome References
Gene Title Yeast GNS1 like
Gene Symbol elo-7
Ensembl F56H11.3
Entrez Gene 186426 Entrez gene
SwissProt Q20904 EMBL-EBI
WormBase CE35559 Wormbase
Functional Annotations
Ortholog
ID Title Organism
YEAST_2:1776363_AT Elongase, involved in fatty acid and sphingolipid biosynthesis; synthesizes very long chain 20-26-carbon fatty acids from C18-CoA primers; involved in regulation of sphingolipid biosynthesis Sc
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA92960 Hypothetical protein F56H11.3 [Caenorhabditis elegans] ref|NP_501691.2| fatty acid ELOngation family member (elo-7) [Caenorhabditis elegans] 0.0
blast CAE72772 Hypothetical protein CBG20025 [Caenorhabditis briggsae] 1.0E-157
blast CAA92960 Hypothetical protein F56H11.3 [Caenorhabditis elegans] ref|NP_501691.2| fatty acid ELOngation family member (elo-7) [Caenorhabditis elegans] 1.0E-125
blast CAA92960 Hypothetical protein F56H11.3 [Caenorhabditis elegans] ref|NP_501691.2| fatty acid ELOngation family member (elo-7) [Caenorhabditis elegans] 1.0E-108
blast CAE72772 Hypothetical protein CBG20025 [Caenorhabditis briggsae] 1.0E-107
blast CAE72772 Hypothetical protein CBG20025 [Caenorhabditis briggsae] 1.0E-96
blast CAA92958 Hypothetical protein F56H11.4 [Caenorhabditis elegans] ref|NP_501689.1| fatty acid ELOngation family member (elo-1) [Caenorhabditis elegans] gb|AAF70462.1| long chain polyunsaturated fatty acid elongation enzyme [Caenorhabditis elegans] 1.0E-54
Protein Domains
Database ID Description E-Value
Pfam IPR002076 EMBL-EBI GNS1/SUR4 membrane protein 1.2E-41
Pfam IPR002076 EMBL-EBI GNS1/SUR4 membrane protein 4.6E-40
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_501691.2 7 61-83,103-125,145-167,174-196,201-218,230-252,267-289
F56H11.3 7 61-83,103-125,145-167,174-196,201-218,230-252,267-289
SNAP00000040069 4 28-50,102-124,131-148,163-185
GENEFINDER00000040075 4 28-50,102-124,131-148,163-185
Sequence
Target Sequence
>C. ELEGANS:189362_AT
gactttatggtctctacggatgtggatgcgaagcactttcaaaccttccgagtcaagcag
aatattggcttttcctgacgatcttgtccaaagctgtggagtttgttgatacatttttct
tggttctccggaaaaaaccactcatcttcctacactggtatcatcatatggcaacatttg
tcttcttctgcagtaattacccgactccatcgtcacaatcacgcgtcggagttatcgtca
acctgttcgtgcatgccttcatgtacccatactatttcacccgatcaatgaacatcaaag
ttcctgcgaaaatttcaatggctgttacagttcttcaattgactcaattcatgtgcttta
tctatggatgtactctcatgtactactcgttggccactaatcaggcacgatacccc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GACTTTATGGTCTCTACGGATGTGG 302 371 389 Antisense
GAAGCACTTTCAAACCTTCCGAGTC 501 339 418 Antisense
GCTTTTCCTGACGATCTTGTCCAAA 358 305 456 Antisense
TGATACATTTTTCTTGGTTCTCCGG 480 563 495 Antisense
TGGCAACATTTGTCTTCTTCTGCAG 233 547 557 Antisense
TCTTCTGCAGTAATTACCCGACTCC 584 615 572 Antisense
GTCACAATCACGCGTCGGAGTTATC 380 459 600 Antisense
TCGGAGTTATCGTCAACCTGTTCGT 352 605 614 Antisense
TCATGTACCCATACTATTTCACCCG 682 621 647 Antisense
TACTCTCATGTACTACTCGTTGGCC 76 647 759 Antisense
GGCCACTAATCAGGCACGATACCCC 641 541 780 Antisense
Sequence Source Affymetrix Proprietary Database