[Home] | [Total List]

[189265_at] cytochrome P450

Description T10H4.11 /REP_DB=WormBase Gene ID /WP=CE16396 /TR=O62377 /GB=CAB03339.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster 6grp_total > 67      4grp_total > 02      6grp_cgc > 48      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/189265_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 6782
1 2 3 4 range
A 40.5
(-3)
A
79.7
(-3)
A
36.8
(-3)
A
6790.6
(3)
P
6754
B 8.4
(-3)
A
52.4
(-3)
A
31
(-3)
A
6062.5
(3)
P
6054
C 41.5
(-3)
A
48.7
(-3)
A
68.4
(-3)
A
6398.2
(3)
P
6357
avr 30.1
(-3)
60.3
(-3)
45.4
(-3)
6417.1
(3)
6387

Warning: fopen(./gnuplot/189265_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2515
1 2 3 4 5 6 range
A 86.1
(-2.8)
A
12.9
(-3)
A
12.9
(-3)
A
7.5
(-3)
A
229.3
(-2.5)
P
2439.4
(3)
P
2432
B 23.2
(-2.9)
A
3.8
(-3)
A
7.6
(-3)
A
7.6
(-3)
A
324.3
(-2.1)
P
2244.5
(3)
P
2241
C 55.9
(-2.9)
A
38.1
(-2.9)
A
9.3
(-3)
A
70.3
(-2.9)
A
218.3
(-2.5)
P
2518.8
(3)
P
2510
avr 55.1
(-2.9)
18.3
(-3)
9.9
(-3)
28.5
(-3)
257.3
(-2.4)
2400.9
(3)
2391
No Scale

Warning: fopen(./gnuplot/189265_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1289
1 2 3 4 range
A 14.7
(-3)
A
17.3
(-3)
A
9.6
(-3)
A
994
(3)
P
984
B 2.7
(-3)
A
12.9
(-3)
A
7.2
(-3)
A
1291.9
(3)
P
1289
C 13.7
(-3)
A
14
(-3)
A
23.8
(-2.9)
A
1078.8
(3)
P
1065
avr 10.4
(-3)
14.7
(-3)
13.5
(-3)
1121.6
(3)
1111

Warning: fopen(./gnuplot/189265_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189265_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 842
1 2 3 4 5 6 range
A 15.9
(-2.9)
A
4.6
(-3)
A
2.8
(-3)
A
1.9
(-3)
A
69.2
(-2.3)
P
593.9
(3)
P
592
B 8.1
(-3)
A
1.3
(-3)
A
1.8
(-3)
A
2
(-3)
A
131.8
(-2.1)
P
837
(3)
P
836
C 20.7
(-2.9)
A
11.6
(-2.9)
A
2.4
(-3)
A
14.1
(-2.9)
A
70.6
(-2.5)
P
843.2
(3)
P
841
avr 14.9
(-2.9)
5.8
(-3)
2.3
(-3)
6
(-3)
90.5
(-2.3)
758
(3)
756
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 189265_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14096
Sequence Type Exemplar sequence
Representative Public ID T10H4.11 NCBI
Target Description T10H4.11 /REP_DB=WormBase Gene ID /WP=CE16396 /TR=O62377 /GB=CAB03339.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074387(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074387 NCBI Caenorhabditis elegans CYtochrome P450 family member (cyp-34A2) (cyp-34A2) mRNA, complete cds. 11/11 None
SNAP00000030483 ENSEMBL cdna:SNAP chromosome:CEL140:V:15291611:15296551:-1 11/11 None
GENEFINDER00000030487 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:15291611:15296551:-1 11/11 None
T10H4.11 ENSEMBL cdna:known chromosome:CEL140:V:15291611:15293672:-1 gene:T10H4.11 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:15291610-15293672(-) 100.0 100.0
Public Domain and Genome References
Gene Title cytochrome P450
Gene Symbol cyp-34A2
Ensembl T10H4.11
Entrez Gene 188400 Entrez gene
SwissProt O62377 EMBL-EBI
WormBase CE16396 Wormbase
Functional Annotations
Ortholog
ID Title Organism
MG-U74AV2:95043_AT cytochrome P450, family 2, subfamily c, polypeptide 70 mm
MOE430A:1424273_AT cytochrome P450, family 2, subfamily c, polypeptide 70 mm
MOUSE430A_2:1424273_AT cytochrome P450, family 2, subfamily c, polypeptide 70 mm
MOUSE430_2:1424273_AT cytochrome P450, family 2, subfamily c, polypeptide 70 mm
MU19KSUBB:TC25980_AT Cytochrome P450, family 2, subfamily c, polypeptide 70, mRNA (cDNA clone MGC:37769 IMAGE:5097081) mm
RT-U34:M58041_S_AT cytochrome P450, family 2, subfamily c, polypeptide 70 rn
RG-U34A:M58041_S_AT cytochrome P450, family 2, subfamily c, polypeptide 70 rn
RAE230A:1387949_AT cytochrome P450, family 2, subfamily c, polypeptide 70 rn
RAT230_2:1387949_AT cytochrome P450, family 2, subfamily c, polypeptide 70 rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4497 monooxygenase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03339 Hypothetical protein T10H4.11 [Caenorhabditis elegans] ref|NP_506788.1| CYtochrome P450 family member (cyp-34A2) [Caenorhabditis elegans] 0.0
blast CAE71667 Hypothetical protein CBG18639 [Caenorhabditis briggsae] 0.0
blast CAB03340 Hypothetical protein T10H4.10 [Caenorhabditis elegans] ref|NP_506787.1| CYtochrome P450 family member (cyp-34A1) [Caenorhabditis elegans] 0.0
Protein Families
Method ID Description E-Value
p450 CPA9_MESAU Animalia; CYP2A9; ham; CPA9_MESAU; Hamster; P24455 1.0E-150
p450 CP1B_HUMAN Animalia; CYP1B1; hum; CP1B_HUMAN; Homo sapiens; Q16678 1.0E-142
Protein Domains
Database ID Description E-Value
Pfam IPR001128 EMBL-EBI Cytochrome P450 3.2E-87
Pfam IPR003002 EMBL-EBI 7TM chemoreceptor, subfamily 1 4.6E-12
Pfam IPR003002 EMBL-EBI 7TM chemoreceptor, subfamily 1 8.8E-18
Pfam IPR001128 EMBL-EBI Cytochrome P450 4.9E-83
Pfam IPR001128 EMBL-EBI Cytochrome P450 2.2E-83
Trans Membrane
ID Number Of Domains Domain Boundaries
SNAP00000030483 6 10-32,45-64,92-114,134-156,213-235,266-288
GENEFINDER00000030487 6 10-32,45-64,92-114,134-156,213-235,262-284
Sequence
Target Sequence
>C. ELEGANS:189265_AT
acaaccttgccatcgacatgtatgatctttggattgctggtcaggagacaacctccacga
ctttggcatgggcatgtgcgtgtcttctcaataaaccagaagtcgtgttgaaagctcgtg
aagagctggttcatgtcaccggaggacatagatcactttcattgactgataagaaagtta
ctccgtatctttcggccgtgattagtgaagtccaacgagttgcctctattctcaacgtca
acctattccgaattcttgaagaggatacatatgttggtggtcaaccaatacgtgctggaa
ctgcagtcaccgcgcacatttcaatgatccatgttgatgagaccttattcaaaaaccata
ctgaattcaatccggagagatttctagaggttgagggtcttgataagaagatgatcccgt
ttggaatcgggaagcgagcgtgcctgggagaatctctagcgaaagctgagttgtacttgg
ttctcgggaacatgctgttagattataatctagaaccagttggagatgtcccgaagattc
aaacaattactccatttgggctgttgaaacgaccaccacc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACAACCTTGCCATCGACATGTATGA 402 113 905 Antisense
GCTGGTCAGGAGACAACCTCCACGA 390 295 940 Antisense
CCTCCACGACTTTGGCATGGGCATG 297 265 956 Antisense
GCATGTGCGTGTCTTCTCAATAAAC 244 311 976 Antisense
TGAAGAGCTGGTTCATGTCACCGGA 87 575 1023 Antisense
CCGTATCTTTCGGCCGTGATTAGTG 375 265 1087 Antisense
AGTTGCCTCTATTCTCAACGTCAAC 230 65 1122 Antisense
ATACGTGCTGGAACTGCAGTCACCG 440 23 1192 Antisense
GAAGCGAGCGTGCCTGGGAGAATCT 435 343 1335 Antisense
GAGTTGTACTTGGTTCTCGGGAACA 130 395 1372 Antisense
TTGGGCTGTTGAAACGACCACCACC 388 701 1460 Antisense
Sequence Source Affymetrix Proprietary Database