[Home] | [Total List]

[189264_s_at] cytochrome P450

Description C26F1.2 /REP_DB=WormBase Gene ID /WP=CE06876 /TR=Q27472 /GB=AAB37074.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster 6grp_highest_10_10 > 24      6grp_high1_10_10 > 31      4grp_highest_8_8 > 45      4grp_high_8_8 > 09      6grp_highest_nonorm > 75      6grp_total > 44      4grp_total > 23      6grp_cgc > 90      6grp_high1_sub > 03      

Scale

Warning: fopen(./gnuplot/189264_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 401
1 2 3 4 range
A 484.4
(2.9)
P
177.5
(-3)
P
201.4
(-2.5)
P
489.8
(3)
P
312
B 570.6
(3)
P
210.4
(-3)
P
262
(-2.1)
P
472.6
(1.4)
P
360
C 505.5
(3)
P
169.6
(-3)
P
239.2
(-1.8)
P
399.1
(1.1)
P
336
avr 520.2
(3)
185.8
(-3)
234.2
(-2.1)
453.8
(1.8)
334

Warning: fopen(./gnuplot/189264_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 433
1 2 3 4 5 6 range
A 845.4
(0.7)
P
895
(3)
P
862
(1.4)
P
768.1
(-3)
P
885.8
(2.6)
P
850
(0.9)
P
127
B 886.7
(1)
P
921.4
(1.7)
P
938.9
(2.1)
P
697.2
(-3)
P
984.2
(3)
P
842.9
(0)
P
287
C 793.8
(-0.8)
P
860.8
(0.1)
P
1067.1
(3)
P
633.9
(-3)
P
913.7
(0.9)
P
732.8
(-1.6)
P
433
avr 842
(0.3)
892.4
(1.5)
956
(3)
699.7
(-3)
927.9
(2.3)
808.6
(-0.5)
256
No Scale

Warning: fopen(./gnuplot/189264_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 143
1 2 3 4 range
A 176.4
(3)
P
38.5
(-3)
P
52.6
(-2.4)
P
71.7
(-1.6)
P
138
B 181.9
(3)
P
52
(-3)
P
60.7
(-2.6)
P
100.7
(-0.8)
P
130
C 167.3
(3)
P
48.7
(-3)
P
83.4
(-1.2)
P
67.3
(-2.1)
P
119
avr 175.2
(3)
46.4
(-3)
65.6
(-2.1)
79.9
(-1.4)
129

Warning: fopen(./gnuplot/189264_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/189264_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 272
1 2 3 4 5 6 range
A 155.8
(-3)
P
318.3
(3)
P
187.7
(-1.8)
P
194.8
(-1.6)
P
267.3
(1.1)
P
207
(-1.1)
P
163
B 308.5
(0.5)
P
306.7
(0.4)
P
228
(-1.8)
P
184.7
(-3)
P
399.9
(3)
P
314.3
(0.6)
P
215
C 294.2
(2.9)
P
262.7
(1.8)
P
271.6
(2.1)
P
127.5
(-3)
P
295.7
(3)
P
245.3
(1.2)
P
168
avr 252.8
(0.3)
295.9
(2)
229.1
(-0.6)
169
(-3)
321
(3)
255.5
(0.4)
152
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 189264_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.11461
Sequence Type Exemplar sequence
Representative Public ID C26F1.2 NCBI
Target Description C26F1.2 /REP_DB=WormBase Gene ID /WP=CE06876 /TR=Q27472 /GB=AAB37074.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072608(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_072608 NCBI Caenorhabditis elegans CYtochrome P450 family member (cyp-32A1) (cyp-32A1) mRNA, complete cds. 11/11 A 
SNAP00000018572 ENSEMBL cdna:SNAP chromosome:CEL140:V:7784407:7787089:1 11/11 None
GENEFINDER00000018580 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:7785622:7787089:1 11/11 None
C26F1.2 ENSEMBL cdna:known chromosome:CEL140:V:7784403:7787146:1 gene:C26F1.2 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:7784407-7787500(+) 100.0 100.0
Public Domain and Genome References
Gene Title cytochrome P450
Gene Symbol cyp-32A1
Ensembl C26F1.2
Entrez Gene 179156 Entrez gene
SwissProt Q27472 EMBL-EBI
WormBase CE32809 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
6614 SRP-dependent cotranslational protein targeting to membrane inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5786 signal recognition particle (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3723 RNA binding inferred from electronic annotation QuickGO AmiGO
4497 monooxygenase activity inferred from electronic annotation QuickGO AmiGO
5525 GTP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB37074 Hypothetical protein C26F1.2 [Caenorhabditis elegans] ref|NP_505009.3| CYtochrome P450 family member (cyp-32A1) [Caenorhabditis elegans] 0.0
blast CAE73190 Hypothetical protein CBG20589 [Caenorhabditis briggsae] 0.0
blast AAB37074 Hypothetical protein C26F1.2 [Caenorhabditis elegans] ref|NP_505009.3| CYtochrome P450 family member (cyp-32A1) [Caenorhabditis elegans] 1.0E-171
blast CAE73190 Hypothetical protein CBG20589 [Caenorhabditis briggsae] 1.0E-141
blast NP_503598 CYtochrome P450 family member (cyp-32B1) [Caenorhabditis elegans] gb|AAF59629.2| Cytochrome p450 family protein 32B1 [Caenorhabditis elegans] 1.0E-131
blast NP_503598 CYtochrome P450 family member (cyp-32B1) [Caenorhabditis elegans] gb|AAF59629.2| Cytochrome p450 family protein 32B1 [Caenorhabditis elegans] 1.0E-126
Protein Families
Method ID Description E-Value
p450 pir:S16068 Animalia; CYP2A-4; mou; pir:S16068; Mus musculus; S16068 1.0E-101
p450 CP12_CAVPO Animalia; CYP1A2; gpi; CP12_CAVPO; Guinea Pig; Q64391 5.0E-74
p450 CP12_CAVPO Animalia; CYP1A2; gpi; CP12_CAVPO; Guinea Pig; Q64391 1.0E-112
Protein Domains
Database ID Description E-Value
Pfam IPR001128 EMBL-EBI Cytochrome P450 4.5E-17
Pfam IPR001128 EMBL-EBI Cytochrome P450 1.6E-77
Pfam IPR001128 EMBL-EBI Cytochrome P450 1.4E-100
Pfam IPR001128 EMBL-EBI Cytochrome P450 1.5E-80
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_505009.3 1 2-24
C26F1.2 1 2-24
SNAP00000018572 1 2-24
Sequence
Target Sequence
>C. ELEGANS:189264_S_AT
gatagcaggtcgagatccatacgcctatattcccttctcggcaggtcctcgtaattgtat
tggacaaaagtttgcacttttggagcagaaaacaatattatcgactttcttccgcaagta
tgaagtggaaagtttgcagacagaagaaaaccttcgaccagtaccagagcttattctcag
accgtataacggtatgaaaattaagataaaacgacgggaagctgcggattat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GATAGCAGGTCGAGATCCATACGCC 101 423 1410 Antisense
AGGTCGAGATCCATACGCCTATATT 609 53 1416 Antisense
ACAATATTATCGACTTTCTTCCGCA 208 115 1501 Antisense
TTATCGACTTTCTTCCGCAAGTATG 340 681 1507 Antisense
GACTTTCTTCCGCAAGTATGAAGTG 31 369 1512 Antisense
GAAGTGGAAAGTTTGCAGACAGAAG 403 333 1531 Antisense
GAAGAAAACCTTCGACCAGTACCAG 205 337 1552 Antisense
CTTCGACCAGTACCAGAGCTTATTC 446 219 1561 Antisense
GTACCAGAGCTTATTCTCAGACCGT 21 459 1570 Antisense
GCTTATTCTCAGACCGTATAACGGT 554 303 1578 Antisense
AAAACGACGGGAAGCTGCGGATTAT 512 131 1617 Antisense
Sequence Source Affymetrix Proprietary Database