[Home] | [Total List]

[188444_at] heat shock protein

Description Y46H3A.2 /REP_DB=WormBase Gene ID /WP=CE22003 /GEN=hsp-16.41 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=heat shock protein
Cluster 6grp_highest_10_10 > 67      6grp_high1_10_10 > 75      4grp_highest_8_8 > 44      4grp_high_8_8 > 08      6grp_highest_nonorm > 69      6grp_total > 76      4grp_total > 31      6grp_highest_sub > In      6grp_cgc > 57      6grp_total_sub > Increase      

Scale

Warning: fopen(./gnuplot/188444_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5014
1 2 3 4 range
A 5186.4
(3)
P
532.2
(-3)
P
1510.8
(-1.7)
P
3081.9
(0.3)
P
4654
B 4301
(3)
P
487.9
(-3)
P
1714.5
(-1.1)
P
3010.6
(1)
P
3813
C 5501.6
(3)
P
541.5
(-3)
P
1698.2
(-1.6)
P
3208.2
(0.2)
P
4960
avr 4996.3
(3)
520.5
(-3)
1641.2
(-1.5)
3100.2
(0.5)
4476

Warning: fopen(./gnuplot/188444_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3931
1 2 3 4 5 6 range
A 1164.5
(-3)
P
1211.3
(-2.9)
P
3086.5
(0.6)
P
2714.3
(-0.1)
P
1698.1
(-2)
P
4390.8
(3)
P
3226
B 1301.9
(-3)
P
1632.9
(-2.5)
P
2628.3
(-0.9)
P
2293.4
(-1.4)
P
2183
(-1.6)
P
5095.9
(3)
P
3794
C 1259.3
(-3)
P
1545.7
(-2.5)
P
1875.7
(-2)
P
2277.8
(-1.3)
P
1850.7
(-2)
P
4919.8
(3)
P
3661
avr 1241.9
(-3)
1463.3
(-2.6)
2530.2
(-0.8)
2428.5
(-1)
1910.6
(-1.9)
4802.2
(3)
3560
No Scale

Warning: fopen(./gnuplot/188444_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1773
1 2 3 4 range
A 1888.4
(3)
P
115.5
(-3)
P
395
(-2.1)
P
451.1
(-1.9)
P
1773
B 1371.5
(3)
P
120.5
(-3)
P
397.3
(-1.7)
P
641.6
(-0.5)
P
1251
C 1821.2
(3)
P
155.7
(-3)
P
591.9
(-1.4)
P
541
(-1.6)
P
1666
avr 1693.7
(3)
130.6
(-3)
461.4
(-1.7)
544.6
(-1.4)
1563

Warning: fopen(./gnuplot/188444_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/188444_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1686
1 2 3 4 5 6 range
A 214.7
(-3)
P
430.8
(-1.5)
P
672.2
(0.2)
P
688.4
(0.3)
P
512.4
(-0.9)
P
1069
(3)
P
854
B 453
(-3)
P
543.5
(-2.6)
P
638.2
(-2.2)
P
607.4
(-2.4)
P
886.9
(-1.2)
P
1900.2
(3)
P
1447
C 466.8
(-3)
P
471.6
(-2.9)
P
477.4
(-2.9)
P
458.1
(-3)
P
598.8
(-2.3)
P
1646.9
(3)
P
1189
avr 378.2
(-3)
482
(-2.5)
595.9
(-1.9)
584.6
(-1.9)
666
(-1.5)
1538.7
(3)
1161
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 188444_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14799
Sequence Type Exemplar sequence
Representative Public ID Y46H3A.2 NCBI
Target Description Y46H3A.2 /REP_DB=WormBase Gene ID /WP=CE22003 /GEN=hsp-16.41 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=heat shock protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_182316(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_182316 NCBI Caenorhabditis elegans Heat Shock Protein family member (hsp-16.41) (hsp-16.41) mRNA, complete cds. 11/11 None
SNAP00000020848 ENSEMBL cdna:SNAP chromosome:CEL140:V:1805099:1805588:1 11/11 None
GENEFINDER00000020854 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:1805099:1805588:1 11/11 None
Y46H3A.2 ENSEMBL cdna:known chromosome:CEL140:V:1805099:1805588:1 gene:Y46H3A.2 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
X01577 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:1805098-1805588(+) 100.0 100.0
chrV:9091867-9092354(-) 92.13 92.13
Public Domain and Genome References
Gene Title heat shock protein
Gene Symbol hsp-16.41
Ensembl Y46H3A.2
Entrez Gene 178660 Entrez gene
SwissProt P06581 EMBL-EBI
WormBase CE22003 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast NP_872116 Heat Shock Protein family member (hsp-16.41) [Caenorhabditis elegans] gb|AAF60616.1| Heat shock protein protein 16.41 [Caenorhabditis elegans] sp|P06581|HSP16_CAEEL Heat shock protein Hsp-16.41 3.0E-77
blast AAA28070 heat shock protein 16-41 7.0E-76
blast AAB04841 Heat shock protein protein 16.49 [Caenorhabditis elegans] gb|AAB04840.1| Heat shock protein protein 16.48 [Caenorhabditis elegans] ref|NP_505356.1| Heat Shock Protein family member (hsp-16.49) [Caenorhabditis elegans] ref|NP_505355.1| Heat Shock Protein family member (hsp-16.48) [Caenorhabditis elegans] gb|AAA28069.1| heat shock protein 16-48 [Caenorhabditis elegans] sp|P02513|HSP17_CAEEL Heat shock protein Hsp16-48/Hsp16-49 3.0E-72
Protein Domains
Database ID Description E-Value
Pfam IPR002068 EMBL-EBI Heat shock protein Hsp20 2.9E-32
Sequence
Target Sequence
>C. ELEGANS:188444_AT
tctccatattctgattcaaatgctcttgatcatttcttggacgaactcactggatctgtt
caatttccgtattggagaaatgctgatcacaactcattcaatttttccgataatattggg
gagattgtaaatgatgaatccaagttttcggttcaactcgatgtctctcatttcaaacca
gaaaatcttaagattaaattagatggaagagagctcaaaattgaagggattcaagaaaca
aaatcggaacatggatacttgaaacgctcattttcaaaaatgattcttctaccagaagat
gctgatttaccttctgtcaaatctgccatttcgaatgaaggaaaactccaaattgaggct
ccaaagaagacaaactcatcacgttct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCTCCATATTCTGATTCAAATGCTC 228 611 28 Antisense
ATTCTGATTCAAATGCTCTTGATCA 690 9 35 Antisense
TGCTCTTGATCATTTCTTGGACGAA 443 581 48 Antisense
TCTTGGACGAACTCACTGGATCTGT 225 615 62 Antisense
GATGAATCCAAGTTTTCGGTTCAAC 617 407 160 Antisense
TCGGTTCAACTCGATGTCTCTCATT 135 607 175 Antisense
GGAACATGGATACTTGAAACGCTCA 259 529 273 Antisense
TGGATACTTGAAACGCTCATTTTCA 408 547 279 Antisense
AAGATGCTGATTTACCTTCTGTCAA 306 155 323 Antisense
GCTGATTTACCTTCTGTCAAATCTG 205 295 328 Antisense
AAAGAAGACAAACTCATCACGTTCT 571 123 390 Antisense
Sequence Source Affymetrix Proprietary Database