[Home] | [Total List]

[187743_at]

Description Y57A10A.30 /REP_DB=WormBase Gene ID /WP=CE25509 /TR=SW:P56570 /GB=CAB60769.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 96      4grp_total > 0      6grp_cgc > 78      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/187743_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 101
1 2 3 4 range
A 79.6
(-2.4)
A
96.9
(-0.9)
A
73.2
(-3)
A
141
(3)
P
68
B 79.7
(2.2)
M
39.7
(-3)
A
85.6
(3)
A
49.3
(-1.7)
A
46
C 45.8
(-3)
A
46.3
(-2.9)
A
55.7
(-1.3)
A
80.3
(3)
A
35
avr 68.4
(-1.5)
61
(-3)
71.5
(-0.8)
90.2
(3)
29

Warning: fopen(./gnuplot/187743_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 135
1 2 3 4 5 6 range
A 75.2
(-0.2)
A
46.2
(-2.4)
A
38.5
(-3)
A
89.2
(0.9)
A
117.2
(3)
P
115.9
(2.9)
P
79
B 25.2
(-3)
A
44.4
(-2.1)
A
47.9
(-1.9)
A
79.4
(-0.4)
P
149.3
(3)
P
146.5
(2.9)
P
124
C 43.6
(-2.3)
A
76.7
(-0.8)
A
28
(-3)
A
83.3
(-0.5)
M
128.9
(1.6)
P
160.1
(3)
P
132
avr 48
(-2.4)
55.8
(-2)
38.1
(-3)
84
(-0.3)
131.8
(2.5)
140.8
(3)
103
No Scale

Warning: fopen(./gnuplot/187743_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 19
1 2 3 4 range
A 29
(3)
A
21
(-1.8)
A
19.1
(-3)
A
20.6
(-2.1)
P
10
B 25.4
(3)
M
9.8
(-3)
A
19.8
(0.8)
A
10.5
(-2.7)
A
16
C 15.2
(-1.1)
A
13.3
(-3)
A
19.4
(3)
A
13.5
(-2.8)
A
6
avr 23.2
(3)
14.7
(-3)
19.4
(0.3)
14.9
(-2.9)
9

Warning: fopen(./gnuplot/187743_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187743_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 54
1 2 3 4 5 6 range
A 13.9
(-1.8)
A
16.4
(-1.2)
A
8.4
(-3)
A
22.6
(0.2)
A
35.4
(3)
P
28.2
(1.4)
P
27
B 8.8
(-3)
A
14.8
(-2.3)
A
11.6
(-2.7)
A
21
(-1.6)
P
60.7
(3)
P
54.6
(2.3)
P
52
C 16.2
(-1.8)
A
23.4
(-0.9)
A
7.1
(-3)
A
16.8
(-1.7)
M
41.7
(1.5)
P
53.6
(3)
P
47
avr 13
(-2.3)
18.2
(-1.5)
9
(-3)
20.1
(-1.2)
45.9
(3)
45.5
(2.9)
37
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 187743_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.2672
Sequence Type Exemplar sequence
Representative Public ID Y57A10A.30 NCBI
Target Description Y57A10A.30 /REP_DB=WormBase Gene ID /WP=CE25509 /TR=SW:P56570 /GB=CAB60769.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_001027308(11), NM_064207(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_001027308 NCBI Caenorhabditis elegans Initiation Factor 4E (eIF4E) family member (ife-5) (ife-5) mRNA, complete cds. 11/11 None
NM_064207 NCBI Caenorhabditis elegans Initiation Factor 4E (eIF4E) family member (ife-5) (ife-5) mRNA, complete cds. 11/11 None
GENEFINDER00000026039 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:12283266:12283924:1 11/11 None
Y57A10A.30b.2 ENSEMBL cdna:known chromosome:CEL140:II:12280565:12283924:1 gene:Y57A10A.30 11/11 None
Y57A10A.30a ENSEMBL cdna:known chromosome:CEL140:II:12282757:12284022:1 gene:Y57A10A.30 11/11 None
Y57A10A.30b.1 ENSEMBL cdna:known chromosome:CEL140:II:12282783:12283924:1 gene:Y57A10A.30 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000026036 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:12282760-12283921(+) 84.23 99.03
Public Domain and Genome References
Ensembl Y57A10A.30
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAB60769 Hypothetical protein Y57A10A.30a [Caenorhabditis elegans] ref|NP_496608.3| Initiation Factor 4E (eIF4E) family member (ife-5) [Caenorhabditis elegans] sp|P56570|IF4E5_CAEEL Eukaryotic translation initiation factor 4E-5 (eIF4E-5) (eIF-4E-5) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) 1.0E-142
blast CAB55035 Hypothetical protein Y57A10A.30b [Caenorhabditis elegans] ref|NP_001022479.1| Initiation Factor 4E (eIF4E) family member (ife-5) [Caenorhabditis elegans] gb|AAF62415.1| translation initiation factor eIF4E isoform 5 [Caenorhabditis elegans] pir||T31652 hypothetical protein Y57A10A.ee - Caenorhabditis elegans 1.0E-119
blast CAB60769 Hypothetical protein Y57A10A.30a [Caenorhabditis elegans] ref|NP_496608.3| Initiation Factor 4E (eIF4E) family member (ife-5) [Caenorhabditis elegans] sp|P56570|IF4E5_CAEEL Eukaryotic translation initiation factor 4E-5 (eIF4E-5) (eIF-4E-5) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) 1.0E-119
Protein Domains
Database ID Description E-Value
Pfam IPR001040 EMBL-EBI Eukaryotic translation initiation factor 4E (eIF-4E) 1.6E-103
Pfam IPR001040 EMBL-EBI Eukaryotic translation initiation factor 4E (eIF-4E) 9.7E-105
Sequence
Target Sequence
>C. ELEGANS:187743_AT
tgactgaattgacgacacccatctatcctctgcagcggaactggtcgtggtggttcttga
acgatgatcgcaacgcgtcttggcaggatcgtctgaaaaaggtgtacaccttcaacaccg
taccggaattctgggctttctacgaagctatccttccaccaagtggcctcaacgatctgt
gcgattacaacgttttccgtgacgatattcagccgaaatgggaggctccggaaaactggg
atggtggacgttggctcattatcattaacaagggaaagactcccgaagtgttggacgccg
tttggctggaaattctcttggctttgatcggcgagcaattcggaaaggatatggagtcga
tttgtgggctggtgtgtaacgtcagaggacagggatcgaagatcagcgtctggactaaaa
actgtaatgatgatgatactaatatgaggattggagttgtgctgaaggagaagctgatgg
ccgcggcatccaaggcacactcgaagccactgttcgacgtgattcactaccaaacacata
ggaattgcgtgaagaagaccacctcggct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGACTGAATTGACGACACCCATCTA 183 571 131 Antisense
ATCTATCCTCTGCAGCGGAACTGGT 596 21 151 Antisense
CAACGCGTCTTGGCAGGATCGTCTG 412 187 201 Antisense
TACCGGAATTCTGGGCTTTCTACGA 160 651 251 Antisense
TGGCCTCAACGATCTGTGCGATTAC 466 543 294 Antisense
GGATGGTGGACGTTGGCTCATTATC 206 515 369 Antisense
GTGTTGGACGCCGTTTGGCTGGAAA 35 485 418 Antisense
GGAAATTCTCTTGGCTTTGATCGGC 445 527 438 Antisense
GGCATCCAAGGCACACTCGAAGCCA 299 537 615 Antisense
GAAGCCACTGTTCGACGTGATTCAC 497 345 633 Antisense
TTGCGTGAAGAAGACCACCTCGGCT 551 691 675 Antisense
Sequence Source Affymetrix Proprietary Database