[Home] | [Total List]

[187164_at]

Description Y57A10A.25 /REP_DB=WormBase Gene ID /WP=CE22629 /TR=Q9NA76 /GB=CAB55029.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_high1_10_10 > 93      4grp_high_8_8 > 44      6grp_total > 97      4grp_total > 61      6grp_high1_sub > 04      6grp_total_sub > Increase      

Scale

Warning: fopen(./gnuplot/187164_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 82
1 2 3 4 range
A 293.7
(3)
P
254.1
(-3)
M
288.7
(2.2)
P
257.3
(-2.5)
A
40
B 280.6
(3)
P
224
(-2)
M
261.3
(1.3)
P
212.8
(-3)
P
68
C 247.6
(-1.3)
P
294.5
(3)
P
243.5
(-1.7)
P
229.7
(-3)
P
65
avr 274
(3)
257.5
(0.6)
264.5
(1.6)
233.3
(-3)
41

Warning: fopen(./gnuplot/187164_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 146
1 2 3 4 5 6 range
A 224.8
(-2)
A
237.5
(-1.4)
M
199.9
(-3)
A
235.7
(-1.5)
A
299.2
(1.2)
P
342.3
(3)
P
142
B 238.4
(-3)
P
249.6
(-2.4)
P
276.6
(-0.9)
P
346.4
(3)
P
257.5
(-1.9)
P
344.6
(2.9)
P
108
C 275.2
(-0.4)
P
249.6
(-1.8)
P
272.2
(-0.5)
A
229.2
(-3)
M
334.5
(3)
P
322.6
(2.3)
P
105
avr 246.1
(-3)
245.6
(-3)
249.6
(-2.7)
270.4
(-1.4)
297.1
(0.4)
336.5
(3)
91
No Scale

Warning: fopen(./gnuplot/187164_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 69
1 2 3 4 range
A 106.9
(3)
P
55.2
(-1.5)
M
75.5
(0.3)
P
37.7
(-3)
A
69
B 89.5
(3)
P
55.3
(-1.6)
M
60.6
(-0.9)
P
45.3
(-3)
P
44
C 82
(2.6)
P
84.7
(3)
P
84.9
(3)
P
38.7
(-3)
P
46
avr 92.8
(3)
65.1
(-0.2)
73.7
(0.8)
40.6
(-3)
52

Warning: fopen(./gnuplot/187164_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187164_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 87
1 2 3 4 5 6 range
A 41.4
(-3)
A
84.5
(2.3)
M
43.5
(-2.7)
A
59.8
(-0.7)
A
90.3
(3)
P
83.4
(2.2)
P
49
B 83
(-1.5)
P
83.1
(-1.4)
P
67.2
(-3)
P
91.7
(-0.6)
P
104.6
(0.7)
P
128.5
(3)
P
61
C 102
(2.4)
P
76.2
(-0.1)
P
69.3
(-0.8)
A
46.1
(-3)
M
108.2
(3)
P
108
(3)
P
62
avr 75.5
(-1)
81.3
(-0.3)
60
(-3)
65.9
(-2.2)
101
(2.3)
106.6
(3)
47
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 187164_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.3293
Sequence Type Exemplar sequence
Representative Public ID Y57A10A.25 NCBI
Target Description Y57A10A.25 /REP_DB=WormBase Gene ID /WP=CE22629 /TR=Q9NA76 /GB=CAB55029.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064201(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_064201 NCBI Caenorhabditis elegans Y57A10A.25 (Y57A10A.25) mRNA, complete cds. 11/11 None
SNAP00000026030 ENSEMBL cdna:SNAP chromosome:CEL140:II:12249598:12256529:-1 11/11 None
GENEFINDER00000026065 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:12251865:12256529:-1 11/11 None
Y57A10A.25 ENSEMBL cdna:known chromosome:CEL140:II:12251648:12256530:-1 gene:Y57A10A.25 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:12251861-12256526(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y57A10A.25
Entrez Gene 174866 Entrez gene
SwissProt Q9NA76 EMBL-EBI
WormBase CE22629 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE:1591367_AT similar to target of EGR1, member 1 (nuclear) cfa
CANINE:1584355_AT similar to target of EGR1, member 1 (nuclear) cfa
CANINE_2:CFA.5291.1.A1_AT similar to target of EGR1, member 1 (nuclear) cfa
CANINE_2:CFAAFFX.7855.1.S1_AT similar to target of EGR1, member 1 (nuclear) cfa
CHICKEN:GGA.13088.1.S1_AT similar to TOE1 homolog gga
CHICKEN:GGA.19869.1.S1_S_AT similar to TOE1 homolog gga
HG-U133_PLUS_2:204080_AT target of EGR1, member 1 (nuclear) hs
HG-U133A:204080_AT target of EGR1, member 1 (nuclear) hs
HG-U133A_2:204080_AT target of EGR1, member 1 (nuclear) hs
HU35KSUBB:RC_W33179_AT target of EGR1, member 1 (nuclear) hs
U133_X3P:G13376627_3P_AT target of EGR1, member 1 (nuclear) hs
HG-U95AV2:33165_AT target of EGR1, member 1 (nuclear) hs
MOUSE430A_2:1432207_A_AT target of EGR1, member 1 (nuclear) mm
MOE430A:1432207_A_AT target of EGR1, member 1 (nuclear) mm
MOUSE430_2:1432207_A_AT target of EGR1, member 1 (nuclear) mm
MG-U74BV2:110329_AT target of EGR1, member 1 (nuclear) mm
MOE430A:1426527_AT target of EGR1, member 1 (nuclear) mm
MOUSE430A_2:1426527_AT target of EGR1, member 1 (nuclear) mm
MOUSE430_2:1426527_AT target of EGR1, member 1 (nuclear) mm
MU19KSUBA:TC18042_AT Target of EGR1, member 1 (nuclear) (Toe1), mRNA mm
MU19KSUBC:TC37739_AT Target of EGR1, member 1 (nuclear) (Toe1), mRNA mm
RG-U34B:RC_AA996476_S_AT target of EGR1, member 1 (nuclear) (predicted) rn
RG-U34C:RC_AI178466_G_AT target of EGR1, member 1 (nuclear) (predicted) rn
RG-U34C:RC_AI178466_AT target of EGR1, member 1 (nuclear) (predicted) rn
RG-U34C:RC_AI229191_AT target of EGR1, member 1 (nuclear) (predicted) rn
RAE230A:1389865_AT target of EGR1, member 1 (nuclear) (predicted) rn
RAT230_2:1389865_AT target of EGR1, member 1 (nuclear) (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
16481 negative regulation of transcription inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
16564 transcriptional repressor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB55029 Hypothetical protein Y57A10A.25 [Caenorhabditis elegans] ref|NP_496602.1| Y57A10A.25 [Caenorhabditis elegans] 0.0
blast CAE73482 Hypothetical protein CBG20934 [Caenorhabditis briggsae] 0.0
blast AAF60509 Hypothetical protein Y39A3A.1 [Caenorhabditis elegans] 3.0E-77
blast XP_791390 PREDICTED: similar to target of EGR1, member 1 (nuclear) [Strongylocentrotus purpuratus] 4.0E-48
Protein Domains
Database ID Description E-Value
Pfam IPR006941 EMBL-EBI CAF1 family ribonuclease 1.0E-106
Sequence
Target Sequence
>C. ELEGANS:187164_AT
cgatcttcacatccacgtgtgcaaatatttcgcgtatcacggcttctgccacgctcggaa
cactgaaaaaggatgtaaactgctccatgacgtggatactgctatcgatttacagaggat
taaggagaataagaaggcgttcaaacgaaaacggagatataataatgtgattgctgaatc
ggttgccgagaagacgggcaccgatgaggaggcatggaagaacgcgaaatttgagcagaa
tttgttgactcgagactttcgggagctcaagagaaatgtggttacagggctgcatcgggc
tggagttgatgcttttatgacggcttttgcggtgatttatcagcagagaagaaccctgat
ggctgataattcagttgatttgaagttcctaaaccgcgttccactgtccgccaaagataa
gccattgcatcttcgccaccgaccggtcccagttccacaatccgagcaaattgatgctca
tttggaggcaatggtggagatcaacaagcaacgggactatattcgaatgaatgcagccgc
tacagttatcaaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CGATCTTCACATCCACGTGTGCAAA 640 247 897 Antisense
AATATTTCGCGTATCACGGCTTCTG 514 173 920 Antisense
CTGCCACGCTCGGAACACTGAAAAA 357 237 942 Antisense
GGATGTAAACTGCTCCATGACGTGG 22 515 967 Antisense
AGACGGGCACCGATGAGGAGGCATG 428 67 1088 Antisense
GTTGACTCGAGACTTTCGGGAGCTC 551 437 1140 Antisense
ATGTGGTTACAGGGCTGCATCGGGC 511 49 1172 Antisense
GACGGCTTTTGCGGTGATTTATCAG 112 377 1215 Antisense
GTTCCACTGTCCGCCAAAGATAAGC 339 437 1294 Antisense
AAGATAAGCCATTGCATCTTCGCCA 438 155 1310 Antisense
AATGCAGCCGCTACAGTTATCAAAA 607 165 1426 Antisense
Sequence Source Affymetrix Proprietary Database