[Home] | [Total List]

[187149_at]

Description Y57A10A.31 /REP_DB=WormBase Gene ID /WP=CE22610 /TR=Q9NA71 /GB=CAB55036.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 93      4grp_total > 11      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/187149_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 32
1 2 3 4 range
A 15.2
(0.7)
A
10.2
(-3)
A
18.4
(3)
A
12.5
(-1.3)
A
8
B 6.4
(-3)
A
18.7
(3)
A
7.5
(-2.5)
A
18.1
(2.7)
A
12
C 16.9
(-0.9)
A
8.8
(-2.5)
A
6
(-3)
A
37.8
(3)
A
32
avr 12.8
(-1.9)
12.6
(-2)
10.6
(-3)
22.8
(3)
12

Warning: fopen(./gnuplot/187149_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 42
1 2 3 4 5 6 range
A 14.8
(-1.4)
A
10.3
(-2.4)
A
34.1
(3)
A
7.6
(-3)
A
29
(1.8)
A
22.7
(0.4)
A
27
B 7.7
(-1.3)
A
13.2
(3)
A
8.6
(-0.6)
A
6.4
(-2.4)
A
5.6
(-3)
A
6.8
(-2.1)
A
8
C 3.7
(-3)
A
15.4
(-1.3)
A
4.7
(-2.9)
A
5.8
(-2.7)
A
45.7
(3)
A
12.9
(-1.7)
A
42
avr 8.7
(-2.4)
13
(-1.1)
15.8
(-0.3)
6.6
(-3)
26.8
(3)
14.1
(-0.8)
20
No Scale

Warning: fopen(./gnuplot/187149_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5
1 2 3 4 range
A 5.5
(3)
A
2.2
(-2.4)
A
4.8
(1.9)
A
1.8
(-3)
A
4
B 2
(-2.4)
A
4.6
(3)
A
1.7
(-3)
A
3.9
(1.6)
A
3
C 5.6
(1.9)
A
2.5
(-2.4)
A
2.1
(-3)
A
6.4
(3)
A
4
avr 4.4
(3)
3.1
(-2.2)
2.9
(-3)
4
(1.4)
2

Warning: fopen(./gnuplot/187149_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/187149_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 14
1 2 3 4 5 6 range
A 2.7
(-2.3)
A
3.6
(-1.5)
A
7.4
(1.8)
A
1.9
(-3)
A
8.8
(3)
A
5.5
(0.1)
A
7
B 2.7
(-0.8)
A
4.4
(3)
A
2.1
(-2.1)
A
1.7
(-3)
A
2.3
(-1.7)
A
2.5
(-1.2)
A
3
C 1.4
(-2.9)
A
4.7
(-1.5)
A
1.2
(-3)
A
1.2
(-3)
A
14.8
(3)
A
4.3
(-1.6)
A
14
avr 2.3
(-2.4)
4.2
(-0.8)
3.6
(-1.3)
1.6
(-3)
8.6
(3)
4.1
(-0.9)
7
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 187149_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.2814
Sequence Type Exemplar sequence
Representative Public ID Y57A10A.31 NCBI
Target Description Y57A10A.31 /REP_DB=WormBase Gene ID /WP=CE22610 /TR=Q9NA71 /GB=CAB55036.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064208(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_064208 NCBI Caenorhabditis elegans Y57A10A.31 (Y57A10A.31) mRNA, complete cds. 11/11 None
SNAP00000026037 ENSEMBL cdna:SNAP chromosome:CEL140:II:12289308:12299971:1 11/11 None
GENEFINDER00000026046 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:12289308:12299976:1 11/11 None
Y57A10A.31 ENSEMBL cdna:known chromosome:CEL140:II:12289308:12298987:1 gene:Y57A10A.31 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:12289304-12298984(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y57A10A.31
Entrez Gene 174872 Entrez gene
SwissProt Q9NA71 EMBL-EBI
WormBase CE22610 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAB55036 Hypothetical protein Y57A10A.31 [Caenorhabditis elegans] ref|NP_496609.1| Y57A10A.31 [Caenorhabditis elegans] 0.0
blast CAE73475 Hypothetical protein CBG20927 [Caenorhabditis briggsae] 0.0
blast CAE68324 Hypothetical protein CBG14039 [Caenorhabditis briggsae] 0.0
Sequence
Target Sequence
>C. ELEGANS:187149_AT
tgtcatcgggttttgacgccagctgagattatgaacatcattctcggcggctcggatcga
atgaaagagctcgacacccaaaaactccgccgtcttaccgatcgtgccaagcagctgctc
attcaaaccaatgaagatcttgccgcatgcccatcagcggattgtgtcggaattctctcg
aaatccgacgatggactaatttccgagttcaaaaagtgtgaagcttgtgatcgaagctat
tgccgaaaatgtctcgccgagccccatccggatgatacgtgtgaagagtttgctcgtatc
cgacgcccggaagactcgattgctcgctatcagaaggacatgggatcccgcgttaagaag
tgcccgaaatgtgcagttttggttgaaaaacgagagggatgtaatcatatgcagtgtggt
tgtggaacacattactgctggacgtgtctctatgttgctgaaagctctggtgactgctat
cgtc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGTCATCGGGTTTTGACGCCAGCTG 599 557 2569 Antisense
TTCTCGGCGGCTCGGATCGAATGAA 19 691 2609 Antisense
TCGTGCCAAGCAGCTGCTCATTCAA 73 605 2670 Antisense
TGCCGCATGCCCATCAGCGGATTGT 677 583 2709 Antisense
AGCGGATTGTGTCGGAATTCTCTCG 617 81 2724 Antisense
TATTGCCGAAAATGTCTCGCCGAGC 664 661 2806 Antisense
TGAAGAGTTTGCTCGTATCCGACGC 138 575 2850 Antisense
ATCCGACGCCCGGAAGACTCGATTG 598 37 2866 Antisense
GGGATCCCGCGTTAAGAAGTGCCCG 421 487 2910 Antisense
GGACGTGTCTCTATGTTGCTGAAAG 579 523 3008 Antisense
GAAAGCTCTGGTGACTGCTATCGTC 94 359 3028 Antisense
Sequence Source Affymetrix Proprietary Database