[Home] | [Total List]

[186704_s_at]

Description F57B10.11 /REP_DB=WormBase Gene ID /WP=CE11318 /TR=O44739 /GB=AAB96728.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 48      6grp_high1_10_10 > 74      4grp_highest_8_8 > 13      4grp_high_8_8 > 23      6grp_highest_nonorm > 75      6grp_total > 65      4grp_total > 24      6grp_cgc > 66      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/186704_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 516
1 2 3 4 range
A 546.4
(-3)
P
641.4
(-1.2)
P
662
(-0.8)
P
857
(3)
P
311
B 570.2
(-3)
P
598.8
(-1.7)
P
704.4
(3)
P
663
(1.1)
P
134
C 467
(-3)
P
463.5
(-3)
P
881.1
(1.9)
P
979.9
(3)
P
516
avr 527.9
(-3)
567.9
(-2.2)
749.2
(1.3)
833.3
(3)
305

Warning: fopen(./gnuplot/186704_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 559
1 2 3 4 5 6 range
A 776.3
(-0.8)
P
648.2
(-3)
P
860.2
(0.6)
P
1004.4
(3)
P
901
(1.3)
P
888.2
(1)
P
356
B 902.9
(-0.6)
P
969.6
(0.4)
P
1140.9
(3)
P
819.7
(-1.9)
P
744.5
(-3)
P
1022.9
(1.2)
P
396
C 582.1
(-3)
P
956.7
(1.4)
P
754.9
(-1)
P
1094.8
(3)
P
810.5
(-0.3)
P
1008
(2)
P
513
avr 753.8
(-3)
858.2
(-0.1)
918.7
(1.5)
973
(3)
818.7
(-1.2)
973
(3)
219
No Scale

Warning: fopen(./gnuplot/186704_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 182
1 2 3 4 range
A 198.9
(3)
P
139.2
(-1.9)
P
173.1
(0.9)
P
125.4
(-3)
P
74
B 181.8
(3)
P
147.9
(-2)
P
163.2
(0.2)
P
141.3
(-3)
P
41
C 154.6
(-2.3)
P
133.2
(-3)
P
307.1
(3)
P
165.2
(-1.9)
P
174
avr 178.4
(0.1)
140.1
(-3)
214.5
(3)
144
(-2.7)
74

Warning: fopen(./gnuplot/186704_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186704_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 238
1 2 3 4 5 6 range
A 143.1
(-3)
P
230.5
(1.1)
P
187.3
(-0.9)
P
254.8
(2.2)
P
271.9
(3)
P
216.2
(0.4)
P
129
B 314.2
(0.5)
P
322.7
(0.9)
P
277.1
(-0.8)
P
217.1
(-3)
P
302.5
(0.1)
P
381.4
(3)
P
164
C 215.8
(-2)
P
291.9
(1.1)
P
192.1
(-3)
P
220.2
(-1.8)
P
262.3
(-0.1)
P
337.4
(3)
P
145
avr 224.4
(-2.6)
281.7
(1.1)
218.8
(-3)
230.7
(-2.2)
278.9
(0.9)
311.7
(3)
93
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 186704_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1225
Sequence Type Exemplar sequence
Representative Public ID F57B10.11 NCBI
Target Description F57B10.11 /REP_DB=WormBase Gene ID /WP=CE11318 /TR=O44739 /GB=AAB96728.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_059492(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_059492 NCBI Caenorhabditis elegans BAG1 (human) homolog family member (bag-1) (bag-1) mRNA, complete cds. 11/11 None
SNAP00000011832 ENSEMBL cdna:SNAP chromosome:CEL140:I:6571845:6572583:-1 11/11 None
GENEFINDER00000011839 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:6571845:6572583:-1 11/11 None
F57B10.11 ENSEMBL cdna:known chromosome:CEL140:I:6571841:6572583:-1 gene:F57B10.11 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:6571773-6572512(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol bag-1
Ensembl F57B10.11
Entrez Gene 172373 Entrez gene
SwissProt O44739 EMBL-EBI
WormBase CE11318 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6915 apoptosis inferred from electronic annotation QuickGO AmiGO
16049 cell growth inferred from sequence similarity QuickGO AmiGO
6950 response to stress inferred from sequence similarity QuickGO AmiGO
6457 protein folding inferred from sequence similarity QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5515 protein binding inferred from electronic annotation QuickGO AmiGO
51087 chaperone binding inferred from sequence similarity QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB96728 Bag1 (human) homolog protein 1 [Caenorhabditis elegans] ref|NP_491893.1| BAG1 (human) homolog family member (bag-1) [Caenorhabditis elegans] gb|AAD16125.1| BAG-family molecular chaperone regulator-1 [Caenorhabditis elegans] 1.0E-114
blast CAE67218 Hypothetical protein CBG12655 [Caenorhabditis briggsae] 4.0E-98
blast 1T7S Chain , Structural Genomics Of Caenorhabditis Elegans: Structure Of Bag-1 Protein pdb|1T7S|A Chain A, Structural Genomics Of Caenorhabditis Elegans: Structure Of Bag-1 Protein 1.0E-68
Protein Domains
Database ID Description E-Value
Pfam IPR000626 EMBL-EBI Ubiquitin 0.0027
Pfam IPR003103 EMBL-EBI Apoptosis regulator Bcl-2 protein, BAG 9.9E-29
Sequence
Target Sequence
>C. ELEGANS:186704_S_AT
tgtcgtgttcatccgttcaaactacaatcgacattcttgaggaaaatcaaggagaagacg
aatctattttgacacttgggcagctacgcgatcgaatcgccaccgacaatgatgttgatg
ttgaaaccatgaagttgttgcacagaggaaagtttcttcaaggcgccgacgatgtctccc
tttctactttaaattttaaagaaaatgataaaatcattgtgatgggtggaaaaaatgctt
tggttgatgacgcgggcttcaaaatgctcatgcaatatgagaagcataatttgagcaatc
ttcaaaaagcctatgatctcaatttgagagatgtcgctgatttggaacgtggttttctcg
aaaaaccaaagcaggtcgagatggggaaaaagctggaaaagaaagtgaaatatttcaacg
aagaggcggaaagacatctggaaactcttgatgggatgaatattatcactgaaactactc
ccgaaaatcaggctaagcgaaaccgtgaaaaacgcaagacgctcgtaaacggaatccaaa
ctcttcttaatcaaaatgacgcacttcttcggagact


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGTCGTGTTCATCCGTTCAAACTAC 357 557 26 Antisense
TTTGACACTTGGGCAGCTACGCGAT 145 667 93 Antisense
GATCGAATCGCCACCGACAATGATG 303 417 115 Antisense
GAGGAAAGTTTCTTCAAGGCGCCGA 540 403 170 Antisense
AATGCTTTGGTTGATGACGCGGGCT 74 167 259 Antisense
TGACGCGGGCTTCAAAATGCTCATG 603 569 273 Antisense
GAGATGTCGCTGATTTGGAACGTGG 459 395 353 Antisense
ATTATCACTGAAACTACTCCCGAAA 352 13 487 Antisense
GCAAGACGCTCGTAAACGGAATCCA 471 319 539 Antisense
ACGGAATCCAAACTCTTCTTAATCA 469 93 554 Antisense
AAAATGACGCACTTCTTCGGAGACT 189 133 578 Antisense
Sequence Source Affymetrix Proprietary Database