[Home] | [Total List]

[186230_at] 7TM chemoreceptor, srb family

Description C27D6.10 /REP_DB=WormBase Gene ID /WP=CE06890 /GEN=srb-1 /GB=AAK68205.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 73      4grp_total > 05      6grp_cgc > 90      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/186230_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 80
1 2 3 4 range
A 19.7
(-1.5)
A
0.9
(-3)
A
6.4
(-2.6)
A
76.5
(3)
P
76
B 34.7
(1.4)
P
1.5
(-3)
A
23.7
(-0)
A
46.5
(3)
M
45
C 17.1
(-1.8)
A
2
(-3)
A
7.6
(-2.6)
A
80.5
(3)
P
79
avr 23.8
(-1)
1.5
(-3)
12.6
(-2)
67.8
(3)
66

Warning: fopen(./gnuplot/186230_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 37
1 2 3 4 5 6 range
A 24.8
(0.7)
A
1.7
(-3)
A
39
(3)
A
11
(-1.5)
A
21.7
(0.2)
A
1.8
(-3)
A
37
B 2.5
(-2.8)
A
1.8
(-3)
A
13.7
(0.7)
A
4.6
(-2.1)
A
21.1
(3)
P
14.9
(1.1)
A
19
C 3.3
(-2.8)
A
15.7
(0)
A
2.4
(-3)
A
28.6
(3)
A
8.1
(-1.7)
A
6.3
(-2.1)
A
26
avr 10.2
(-1.1)
6.4
(-3)
18.4
(3)
14.7
(1.2)
17
(2.3)
7.7
(-2.4)
12
No Scale

Warning: fopen(./gnuplot/186230_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 13
1 2 3 4 range
A 7.2
(0.8)
A
0.2
(-3)
A
1.7
(-2.2)
A
11.2
(3)
P
11
B 11.1
(3)
P
0.4
(-3)
A
5.5
(-0.1)
A
9.9
(2.3)
M
11
C 5.7
(-0.6)
A
0.6
(-3)
A
2.7
(-2)
A
13.6
(3)
P
13
avr 8
(1.1)
0.4
(-3)
3.3
(-1.4)
11.6
(3)
11

Warning: fopen(./gnuplot/186230_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/186230_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 8
1 2 3 4 5 6 range
A 4.6
(0.1)
A
0.6
(-2.9)
A
8.5
(3)
A
2.8
(-1.2)
A
6.5
(1.5)
A
0.4
(-3)
A
8
B 0.9
(-2.8)
A
0.6
(-3)
A
3.3
(-1)
A
1.2
(-2.6)
A
8.6
(3)
P
5.5
(0.7)
A
8
C 1.2
(-2.3)
A
4.8
(1.9)
A
0.6
(-3)
A
5.7
(3)
A
2.6
(-0.6)
A
2.1
(-1.2)
A
5
avr 2.2
(-2.7)
2
(-3)
4.1
(0.2)
3.2
(-1.2)
5.9
(3)
2.7
(-1.9)
4
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 186230_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5371
Sequence Type Exemplar sequence
Representative Public ID C27D6.10 NCBI
Target Description C27D6.10 /REP_DB=WormBase Gene ID /WP=CE06890 /GEN=srb-1 /GB=AAK68205.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062564(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062564 NCBI Caenorhabditis elegans Serpentine Receptor, class B (beta) family member (srb-1) (srb-1) mRNA, complete cds. 11/11 None
C27D6.10 ENSEMBL cdna:known chromosome:CEL140:II:5169812:5171013:-1 gene:C27D6.10 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
GENEFINDER00000035753 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:5169809-5171011(-) 100.0 100.0
Public Domain and Genome References
Gene Title 7TM chemoreceptor, srb family
Gene Symbol srb-1
Ensembl C27D6.10
Entrez Gene 191783 Entrez gene
SwissProt Q95ZY0 EMBL-EBI
WormBase CE06890 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4888 transmembrane receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_494965 Serpentine Receptor, class B (beta) family member (srb-1) [Caenorhabditis elegans] gb|AAK68205.1| Serpentine receptor, class b (beta) protein 1 [Caenorhabditis elegans] sp|Q95ZY0|SRB1_CAEEL Serpentine receptor class beta-1 (Protein srb-1) prf||2123261N chemosensory receptor 1.0E-176
blast NP_494964 Serpentine Receptor, class B (beta) family member (srb-2) [Caenorhabditis elegans] gb|AAK68210.2| Serpentine receptor, class b (beta) protein 2 [Caenorhabditis elegans] 1.0E-138
blast Q95ZY1 Serpentine receptor class beta-2 (Protein srb-2) prf||2123261P chemosensory receptor 1.0E-137
Protein Domains
Database ID Description E-Value
Pfam IPR002184 EMBL-EBI Integral membrane protein Srb, nematode type 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_494965.1 7 20-42,62-84,104-126,139-161,187-209,242-264,279-301
C27D6.10 7 20-42,62-84,104-126,139-161,187-209,242-264,279-301
Sequence
Target Sequence
>C. ELEGANS:186230_AT
atgttcgtacagtattaggaccacttttgatttttgtattgattggaattgatctgatat
tactttttacggtttttcgagacgaaagttttaatgatagtttcatttcatttattctca
ttcctgcaactactgcacagacgtttaatagttattgctggattcttctatatgcggaac
ttggaaatttactttgtaattgcataattcttctggttcacagcaaattcaaaacaaaat
ttctccatcaacaacgatctttgtctgtacgatatgaactagaagaaatatcccaaactt
caaaattcacgcttattgttagtttcacacatattctatttattggatggtatcttggtg
taacaattttcataagaactgttggggaaacattttttggtagttatatcaactacacag
tggccagaggtgtttacatcagtgtaccaac


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGTTCGTACAGTATTAGGACCACT 131 47 419 Antisense
TAGGACCACTTTTGATTTTTGTATT 481 653 434 Antisense
GATCTGATATTACTTTTTACGGTTT 155 419 469 Antisense
TTTATTCTCATTCCTGCAACTACTG 248 673 529 Antisense
GCAACTACTGCACAGACGTTTAATA 618 319 544 Antisense
ATTGCTGGATTCTTCTATATGCGGA 165 7 572 Antisense
TTGCATAATTCTTCTGGTTCACAGC 129 703 618 Antisense
AACGATCTTTGTCTGTACGATATGA 109 145 671 Antisense
AATTCACGCTTATTGTTAGTTTCAC 35 177 722 Antisense
GTTATATCAACTACACAGTGGCCAG 32 447 821 Antisense
GAGGTGTTTACATCAGTGTACCAAC 498 401 845 Antisense
Sequence Source Affymetrix Proprietary Database