[Home] | [Total List]

[185577_s_at]

Description F19B10.9 /REP_DB=WormBase Gene ID /WP=CE09476 /TR=O02073 /GB=AAB52929.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 78      4grp_total > 0      6grp_cgc > 49      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/185577_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 49
1 2 3 4 range
A 2.1
(-3)
A
2.9
(-2.8)
A
27.3
(3)
A
3.6
(-2.6)
A
25
B 10.7
(3)
A
4.1
(-1.5)
A
1.9
(-3)
A
2.6
(-2.5)
A
9
C 9
(-2.1)
A
2.3
(-2.9)
A
1.5
(-3)
A
50.8
(3)
A
49
avr 7.3
(-1.4)
3.1
(-3)
10.2
(-0.3)
19
(3)
16

Warning: fopen(./gnuplot/185577_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 199
1 2 3 4 5 6 range
A 54
(-1.3)
A
2
(-3)
A
3.2
(-3)
A
5.4
(-2.9)
A
39.4
(-1.8)
A
186.9
(3)
P
185
B 2.2
(-3)
A
1.8
(-3)
A
4.2
(-2.9)
A
2.5
(-3)
A
59.9
(-1.2)
A
200.3
(3)
P
199
C 4.7
(-2.9)
A
2.2
(-3)
A
2.6
(-3)
A
6.9
(-2.8)
A
40.9
(-1.8)
A
189.6
(3)
P
187
avr 20.3
(-2.4)
2
(-3)
3.3
(-3)
4.9
(-2.9)
46.7
(-1.6)
192.3
(3)
190
No Scale

Warning: fopen(./gnuplot/185577_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8
1 2 3 4 range
A 0.8
(-2.7)
A
0.6
(-2.9)
A
7.1
(3)
A
0.5
(-3)
A
7
B 3.4
(3)
A
1
(-1.8)
A
0.4
(-3)
A
0.5
(-2.8)
A
3
C 3
(-1.1)
A
0.7
(-2.9)
A
0.5
(-3)
A
8.6
(3)
A
8
avr 2.4
(1)
0.8
(-3)
2.7
(1.7)
3.2
(3)
2

Warning: fopen(./gnuplot/185577_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185577_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 74
1 2 3 4 5 6 range
A 10
(-1.8)
A
0.7
(-3)
A
0.7
(-3)
A
1.4
(-2.9)
A
11.9
(-1.5)
A
45.5
(3)
P
45
B 0.8
(-3)
A
0.6
(-3)
A
1
(-3)
A
0.7
(-3)
A
24.3
(-1.1)
A
74.7
(3)
P
74
C 1.8
(-2.9)
A
0.7
(-3)
A
0.6
(-3)
A
1.4
(-2.9)
A
13.2
(-1.8)
A
63.5
(3)
P
63
avr 4.2
(-2.7)
0.7
(-3)
0.8
(-3)
1.2
(-3)
16.5
(-1.4)
61.2
(3)
61
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 185577_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4819
Sequence Type Exemplar sequence
Representative Public ID F19B10.9 NCBI
Target Description F19B10.9 /REP_DB=WormBase Gene ID /WP=CE09476 /TR=O02073 /GB=AAB52929.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062210(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062210 NCBI Caenorhabditis elegans T BoX family member (tbx-18) (tbx-18) mRNA, complete cds. 11/11 None
SNAP00000017120 ENSEMBL cdna:SNAP chromosome:CEL140:II:3672011:3673584:-1 11/11 None
GENEFINDER00000017129 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:3672011:3673584:-1 11/11 None
F19B10.9 ENSEMBL cdna:known chromosome:CEL140:II:3671919:3673584:-1 gene:F19B10.9 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:3672009-3673583(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol tbx-18
Ensembl F19B10.9
Entrez Gene 173710 Entrez gene
SwissProt O02073 EMBL-EBI
WormBase CE09476 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6355 regulation of transcription, DNA-dependent inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3700 transcription factor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB52929 T box family protein 18 [Caenorhabditis elegans] ref|NP_494611.1| T BoX family member (tbx-18) [Caenorhabditis elegans] sp|O02073|TBX18_CAEEL Putative T-box protein 0.0
blast CAE66381 Hypothetical protein CBG11641 [Caenorhabditis briggsae] 2.0E-18
blast XP_601563 PREDICTED: similar to T-box 22 [Bos taurus] 3.0E-16
Protein Domains
Database ID Description E-Value
Pfam IPR001699 EMBL-EBI Transcription factor, T-box 1.6E-20
Sequence
Target Sequence
>C. ELEGANS:185577_S_AT
ttctggaagacgtctattcccactcctcgcgtacaaagtctccggactggatccccacaa
gttgtactgcgctggagttcatatgatcccggactcggcttacaagcaagagtatgatca
cgacctgcaacaatgggtgaactgtttgaaccagaaaaagacgattttcaagccgaccag
tgagattttgggccggattgagaatggattcaaacttatgagccttggaatcgatatgtc
tgatgtgaagattttcaatattgcaatcagaaagaagactccattgcagattgagaagag
ccggaagccgaacttagacaaaacgatcgaagttctcatccaatacaagtacctcccggt
gatcaaaatctacgagctgagcaactcgggcatggaaaagaaggaaattgctcaggcaac
attcccggaaacctcattcgtgacggtgtca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TTCTGGAAGACGTCTATTCCCACTC 270 695 585 Antisense
TACAAAGTCTCCGGACTGGATCCCC 109 643 616 Antisense
TCCCCACAAGTTGTACTGCGCTGGA 284 597 636 Antisense
CTGCGCTGGAGTTCATATGATCCCG 79 237 651 Antisense
TATGATCCCGGACTCGGCTTACAAG 542 655 666 Antisense
GAGTATGATCACGACCTGCAACAAT 533 397 694 Antisense
AAAGACGATTTTCAAGCCGACCAGT 530 123 741 Antisense
GCCGACCAGTGAGATTTTGGGCCGG 99 285 756 Antisense
TCATCCAATACAAGTACCTCCCGGT 217 621 920 Antisense
TTGCTCAGGCAACATTCCCGGAAAC 494 703 992 Antisense
GGAAACCTCATTCGTGACGGTGTCA 339 527 1011 Antisense
Sequence Source Affymetrix Proprietary Database