[Home] | [Total List]

[185483_at]

Description C16A11.4 /REP_DB=WormBase Gene ID /WP=CE19354 /TR=O76580 /GB=AAK31410.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 97      4grp_total > 0      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/185483_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 102
1 2 3 4 range
A 7.4
(-3)
A
7.8
(-2.9)
A
50.8
(2.9)
P
51.6
(3)
A
44
B 22.7
(-2.2)
A
10
(-3)
A
76.7
(1.1)
A
107.4
(3)
P
97
C 5.2
(-3)
A
9.7
(-2.6)
A
44
(0.2)
P
78.4
(3)
M
73
avr 11.8
(-2.8)
9.2
(-3)
57.2
(1.1)
79.1
(3)
70

Warning: fopen(./gnuplot/185483_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 373
1 2 3 4 5 6 range
A 28.5
(-3)
A
47.6
(-2.7)
A
54.7
(-2.6)
P
126.6
(-1.3)
P
251.9
(0.8)
P
383.7
(3)
P
355
B 23.8
(-3)
A
41.3
(-2.7)
P
53.9
(-2.5)
P
80.8
(-2)
P
266
(1.3)
P
362.6
(3)
P
339
C 39.5
(-2.4)
A
10.4
(-3)
A
50.2
(-2.2)
P
110.4
(-1)
P
206.1
(0.8)
P
316.8
(3)
P
306
avr 30.6
(-3)
33.1
(-3)
52.9
(-2.6)
105.9
(-1.6)
241.3
(0.9)
354.4
(3)
324
No Scale

Warning: fopen(./gnuplot/185483_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 21
1 2 3 4 range
A 2.7
(-2.5)
A
1.7
(-3)
A
13.3
(3)
P
7.6
(0.1)
A
12
B 7.2
(-1.6)
A
2.5
(-3)
A
17.8
(1.5)
A
22.9
(3)
P
20
C 1.7
(-3)
A
2.8
(-2.5)
A
15.3
(3)
P
13.2
(2.1)
M
14
avr 3.9
(-2.3)
2.3
(-3)
15.5
(3)
14.6
(2.6)
13

Warning: fopen(./gnuplot/185483_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185483_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 132
1 2 3 4 5 6 range
A 5.2
(-3)
A
16.9
(-2.2)
A
11.9
(-2.5)
P
32.1
(-1.2)
P
76
(1.8)
P
93.4
(3)
P
88
B 8.3
(-3)
A
13.8
(-2.7)
P
13.1
(-2.8)
P
21.4
(-2.4)
P
108.1
(1.7)
P
135.2
(3)
P
127
C 14.6
(-2.3)
A
3.2
(-3)
A
12.8
(-2.4)
P
22.2
(-1.9)
P
66.7
(0.7)
P
106.1
(3)
P
103
avr 9.4
(-3)
11.3
(-2.9)
12.6
(-2.8)
25.2
(-2.1)
83.6
(1.4)
111.6
(3)
102
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 185483_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4141
Sequence Type Exemplar sequence
Representative Public ID C16A11.4 NCBI
Target Description C16A11.4 /REP_DB=WormBase Gene ID /WP=CE19354 /TR=O76580 /GB=AAK31410.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062343(9)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062343 NCBI Caenorhabditis elegans C16A11.4 (C16A11.4) mRNA, complete cds. 9/11 None
SNAP00000042938 ENSEMBL cdna:SNAP chromosome:CEL140:II:4227051:4229016:1 9/11 None
GENEFINDER00000042958 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:4227051:4229016:1 11/11 None
C16A11.4 ENSEMBL cdna:known chromosome:CEL140:II:4227040:4229126:1 gene:C16A11.4 9/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4227049-4229015(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl C16A11.4
Entrez Gene 173755 Entrez gene
SwissProt O76580 EMBL-EBI
WormBase CE34688 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6355 regulation of transcription, DNA-dependent inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK31410 Hypothetical protein C16A11.4 [Caenorhabditis elegans] ref|NP_494744.2| C16A11.4 [Caenorhabditis elegans] 0.0
blast AAD12807 Hypothetical protein Y14H12B.2 [Caenorhabditis elegans] ref|NP_494697.1| Y14H12B.2 [Caenorhabditis elegans] 1.0E-54
blast AAD12807 Hypothetical protein Y14H12B.2 [Caenorhabditis elegans] ref|NP_494697.1| Y14H12B.2 [Caenorhabditis elegans] 5.0E-52
blast AAK31409 Hypothetical protein C16A11.3 [Caenorhabditis elegans] ref|NP_494745.1| C16A11.3 [Caenorhabditis elegans] 2.0E-49
Protein Domains
Database ID Description E-Value
Pfam IPR006570 EMBL-EBI SPK 6.7E-41
Sequence
Target Sequence
>C. ELEGANS:185483_AT
ttcacgtttttcttactttcacacattctttttcggctatttagcatttgaaatcgctaa
tagatcttttatagcgatcgccggcgcaccacctgccccagcaaccaccagtctccgcgc
ctttctgcattttctcaaaggctatgtcgactacctggaatccgagcagctggttgactg
cagccgcctgactcaacagcacttggagacttgccgagcggctgacaagctgatttcaat
ggaaaaactgctaacggggcttgccgtcgcaacaaccatcgctgaagcacatctatcgga
tgtttcagccatcatcaacggggcttctgccatggaattttacaaattcatcgagattta
cgcaagtaatcagagcaattcggcattttcgggcctttg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TTCACGTTTTTCTTACTTTCACACA 359 687 1185 Antisense
TCACACATTCTTTTTCGGCTATTTA 142 629 1203 Antisense
GCGCCTTTCTGCATTTTCTCAAAGG 332 287 1301 Antisense
GTCGACTACCTGGAATCCGAGCAGC 217 475 1330 Antisense
CGAGCAGCTGGTTGACTGCAGCCGC 601 249 1347 Antisense
GCCTGACTCAACAGCACTTGGAGAC 250 281 1370 Antisense
GCCGAGCGGCTGACAAGCTGATTTC 171 285 1397 Antisense
GAAAAACTGCTAACGGGGCTTGCCG 430 355 1426 Antisense
CGCAACAACCATCGCTGAAGCACAT 22 255 1452 Antisense
TCATCAACGGGGCTTCTGCCATGGA 381 581 1496 Antisense
GCAATTCGGCATTTTCGGGCCTTTG 117 323 1559 Antisense
Sequence Source Affymetrix Proprietary Database