[Home] | [Total List]

[185023_at]

Description Y56A3A.33 /REP_DB=WormBase Gene ID /WP=CE24469 /TR=Q9U220 /GB=CAB60521.1 /SUBMIT=HINXTON /CHR=3 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 68      6grp_high1_10_10 > 96      4grp_high_8_8 > 06      6grp_highest_nonorm > 90      6grp_total > 86      4grp_total > 02      6grp_highest_sub > In      6grp_cgc > 68      6grp_high1_sub > In      6grp_cgc_sub > In      6grp_total_sub > Increase      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/185023_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5317
1 2 3 4 range
A 183.4
(-2.8)
P
50.6
(-3)
P
59.8
(-3)
P
4678.2
(3)
P
4628
B 224.9
(-2.8)
P
103.3
(-3)
P
82.6
(-3)
P
5189.6
(3)
P
5107
C 190.7
(-2.8)
P
79.5
(-3)
A
49.8
(-3)
P
5366.5
(3)
P
5317
avr 199.7
(-2.8)
77.8
(-3)
64.1
(-3)
5078.1
(3)
5014

Warning: fopen(./gnuplot/185023_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 141
1 2 3 4 5 6 range
A 203
(0.9)
P
116.7
(-3)
P
171.8
(-0.5)
P
154.9
(-1.3)
P
165.1
(-0.8)
P
249.2
(3)
P
133
B 145.7
(-2)
P
126.9
(-3)
P
166
(-0.9)
P
177.2
(-0.3)
P
193
(0.6)
P
238.6
(3)
P
112
C 108
(-3)
P
121.1
(-2.1)
P
151.7
(0.2)
P
162.5
(0.9)
P
190.8
(3)
P
188
(2.8)
P
83
avr 152.2
(-1.2)
121.6
(-3)
163.2
(-0.6)
164.9
(-0.5)
183
(0.6)
225.3
(3)
104
No Scale

Warning: fopen(./gnuplot/185023_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1095
1 2 3 4 range
A 66.8
(-2.5)
P
11
(-3)
P
15.6
(-3)
P
684.8
(3)
P
674
B 71.7
(-2.7)
P
25.5
(-3)
P
19.1
(-3)
P
1105.9
(3)
P
1087
C 63.1
(-2.7)
P
22.9
(-3)
A
17.3
(-3)
P
904.9
(3)
P
888
avr 67.2
(-2.7)
19.8
(-3)
17.3
(-3)
898.5
(3)
881

Warning: fopen(./gnuplot/185023_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185023_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 56
1 2 3 4 5 6 range
A 37.4
(-3)
P
41.5
(-1.9)
P
37.4
(-3)
P
39.3
(-2.5)
P
49.8
(0.2)
P
60.7
(3)
P
23
B 50.7
(-1.7)
P
42.2
(-2.8)
P
40.3
(-3)
P
46.9
(-2.2)
P
78.4
(1.7)
P
89
(3)
P
49
C 40
(-1.5)
P
37
(-2.1)
P
38.6
(-1.8)
P
32.7
(-3)
P
61.8
(2.8)
P
62.9
(3)
P
30
avr 42.7
(-2.3)
40.2
(-2.7)
38.8
(-3)
39.6
(-2.9)
63.3
(1.6)
70.9
(3)
32
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 185023_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.7238
Sequence Type Exemplar sequence
Representative Public ID Y56A3A.33 NCBI
Target Description Y56A3A.33 /REP_DB=WormBase Gene ID /WP=CE24469 /TR=Q9U220 /GB=CAB60521.1 /SUBMIT=HINXTON /CHR=3 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067164(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067164 NCBI Caenorhabditis elegans Y56A3A.33 (Y56A3A.33) mRNA, complete cds. 11/11 A 
SNAP00000035206 ENSEMBL cdna:SNAP chromosome:CEL140:III:11968379:12002816:-1 10/11 None
GENEFINDER00000035215 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:11999485:12002826:-1 10/11 None
Y56A3A.33 ENSEMBL cdna:known chromosome:CEL140:III:11999373:12002826:-1 gene:Y56A3A.33 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:11999368-12002812(-) 97.18 100.0
Public Domain and Genome References
Gene Title
Ensembl Y56A3A.33
Entrez Gene 176636 Entrez gene
SwissProt Q9U220 EMBL-EBI
WormBase CE24469 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE_2:CFAAFFX.29755.1.S1_S_AT similar to transcription elongation factor B polypeptide 3 binding protein 1 cfa
DROSOPHILA_2:1628011_A_AT dm
DROSGENOME1:150748_AT dm
CHICKEN:GGA.19551.1.A1_AT similar to transcription elongation factor B polypeptide 3 binding protein 1; elongin A binding protein 1 gga
CHICKEN:GGA.5256.1.S1_AT similar to transcription elongation factor B polypeptide 3 binding protein 1; elongin A binding protein 1 gga
CHICKEN:GGAAFFX.22959.1.S1_S_AT similar to transcription elongation factor B polypeptide 3 binding protein 1; elongin A binding protein 1 gga
HU35KSUBB:RC_H00278_F_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HU35KSUBD:RC_AA608832_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HU35KSUBD:RC_AA437388_F_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HU35KSUBD:RC_AA437388_I_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
U133_X3P:HS.115726.0.S1_3P_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HG-U133_PLUS_2:226144_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HG-U133B:226144_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HG-U95C:59379_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HG-U95D:84024_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HG-U133_PLUS_2:233939_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
HG-U133B:233939_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) hs
MOUSE430_2:1457116_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MOE430B:1457116_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MU11KSUBA:AA185145_S_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MU11KSUBB:MSA.22459.0_S_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MU11KSUBB:MSA.21997.0_F_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MG-U74AV2:102268_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MG-U74CV2:132883_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MOE430A:1429124_S_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MOUSE430A_2:1429124_S_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MOUSE430_2:1429124_S_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MOE430B:1429489_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MOUSE430_2:1429489_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) mm
MU19KSUBA:TC23854_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) (Rexo1), transcript variant 1, mRNA mm
MU19KSUBC:TC41973_AT REX1, RNA exonuclease 1 homolog (S. cerevisiae) (Rexo1), transcript variant 1, mRNA mm
RG-U34C:RC_AI236603_AT transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RG-U34C:RC_AI071194_AT transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RAE230A:1375372_AT transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RAT230_2:1375372_AT transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RAE230A:1372738_AT transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RAT230_2:1372738_AT transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RAE230B:1378917_AT Transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RAT230_2:1378917_AT Transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
RG-U34B:RC_AI043962_AT Transcription elongation factor B polypeptide 3 binding protein 1 (predicted) rn
YEAST_2:1775381_AT RNA exonuclease; required for maturation of the RNA component of RNase MRP; functions redundantly with Rnh70p and Rex2p in processing of U5 snRNA and RNase P RNA; member of RNase D family of exonucleases Sc
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5622 intracellular inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4527 exonuclease activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB60521 Hypothetical protein Y56A3A.33 [Caenorhabditis elegans] ref|NP_499565.1| Y56A3A.33 [Caenorhabditis elegans] 0.0
blast CAB60506 Hypothetical protein Y56A3A.30 [Caenorhabditis elegans] ref|NP_499562.1| Y56A3A.30 [Caenorhabditis elegans] 0.0
blast AAF39778 Hypothetical protein C51G7.1 [Caenorhabditis elegans] 1.0E-177
blast AAF39778 Hypothetical protein C51G7.1 [Caenorhabditis elegans] 1.0E-176
blast AAF39778 Hypothetical protein C51G7.1 [Caenorhabditis elegans] 1.0E-174
blast CAE67756 Hypothetical protein CBG13331 [Caenorhabditis briggsae] 1.0E-111
Protein Domains
Database ID Description E-Value
Pfam IPR006055 EMBL-EBI Exonuclease 5.6E-21
Pfam IPR005122 EMBL-EBI Uracil-DNA glycosylase superfamily 2.7E-62
Pfam IPR006055 EMBL-EBI Exonuclease 5.6E-21
Sequence
Target Sequence
>C. ELEGANS:185023_AT
gggaggataccctgtgggagtttgtggttagtccacaggcgaaaggaaaggatgatcatc
ggagcaataaggtattcgccctggattgtgagctggtccatactctcaacgggctcgagg
tggctagagtgagcttggtcgacatgaagggcaaagtgctgctggacacttttgcccttc
ctgtatttgaagtaatcagcttcaacagcacgttttcgggcgtcaccgagaaggatatgg
agtcggcgatttcattggaagcgtgtcgcctgcagctcttccaactcatcaactctgaaa
ccctgctcgtcggtcactccctggaatcggatctgaaagctctccgccttgtccaccaca
atgtcatcgacactgcagtcctgttctcgatcgtcgatccatccagatcctacattctca
agttgtcccttcagaatcttgcgaagaaatatctgtgtaaggatgttcagtcggaagcgt
cgggtcattcgtcgattgaggatagccatacttgtatggagcttcttgccactcggcatt
tgtttttttatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGGAGGATACCCTGTGGGAGTTTGT 336 487 482 Antisense
GGAGCAATAAGGTATTCGCCCTGGA 399 517 542 Antisense
TATTCGCCCTGGATTGTGAGCTGGT 154 665 554 Antisense
TTGTGAGCTGGTCCATACTCTCAAC 130 709 567 Antisense
CTCTCAACGGGCTCGAGGTGGCTAG 594 1 584 Antisense
GCTAGAGTGAGCTTGGTCGACATGA 115 303 604 Antisense
AAAGTGCTGCTGGACACTTTTGCCC 578 121 634 Antisense
ACTTTTGCCCTTCCTGTATTTGAAG 148 103 649 Antisense
GCTTCAACAGCACGTTTTCGGGCGT 619 303 680 Antisense
CTTGTATGGAGCTTCTTGCCACTCG 54 217 992 Antisense
GCCACTCGGCATTTGTTTTTTTATT 575 279 1009 Antisense
Sequence Source Affymetrix Proprietary Database