[Home] | [Total List]

[185005_s_at]

Description F23C8.11 /REP_DB=WormBase Gene ID /WP=CE20719 /TR=Q9TXH6 /GB=AAD03133.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 99      4grp_total > 05      6grp_total_sub > Increase      

Scale

Warning: fopen(./gnuplot/185005_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 75
1 2 3 4 range
A 18.1
(-1.3)
A
4.2
(-2.7)
A
0.8
(-3)
A
62.6
(3)
A
62
B 16.6
(-0.9)
A
4.7
(-3)
A
30.2
(1.5)
A
38.9
(3)
A
34
C 45.8
(0.6)
P
2.1
(-3)
A
8.7
(-2.5)
A
75.8
(3)
P
74
avr 26.8
(-0.5)
3.7
(-3)
13.2
(-2)
59.1
(3)
55

Warning: fopen(./gnuplot/185005_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 40
1 2 3 4 5 6 range
A 20.9
(-0.2)
A
19.4
(-0.5)
A
5.2
(-3)
A
5.6
(-2.9)
A
32.6
(1.9)
A
38.8
(3)
A
34
B 5.2
(-2.9)
A
10.6
(-2.1)
A
45
(3)
A
4.8
(-3)
A
18.3
(-1)
A
10.7
(-2.1)
A
40
C 10.2
(-2.7)
A
30
(3)
A
9.2
(-3)
A
21.2
(0.5)
A
21.3
(0.5)
A
19
(-0.2)
A
21
avr 12.1
(-2.3)
20
(1.2)
19.8
(1.1)
10.5
(-3)
24.1
(3)
22.8
(2.4)
14
No Scale

Warning: fopen(./gnuplot/185005_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 15
1 2 3 4 range
A 6.6
(1.3)
A
0.9
(-2.5)
A
0.2
(-3)
A
9.2
(3)
A
9
B 5.3
(0.5)
A
1.2
(-3)
A
7
(1.9)
A
8.3
(3)
A
7
C 15.2
(3)
P
0.6
(-3)
A
3
(-2)
A
12.8
(2)
P
15
avr 9
(2.3)
0.9
(-3)
3.4
(-1.4)
10.1
(3)
9

Warning: fopen(./gnuplot/185005_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185005_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 10
1 2 3 4 5 6 range
A 3.9
(-1.1)
A
6.9
(1)
A
1.1
(-3)
A
1.4
(-2.8)
A
9.8
(3)
A
9.4
(2.7)
A
9
B 1.8
(-2.7)
A
3.5
(-1.6)
A
10.9
(3)
A
1.3
(-3)
A
7.4
(0.8)
A
4
(-1.3)
A
10
C 3.8
(-1.7)
A
9.1
(3)
A
2.3
(-3)
A
4.3
(-1.2)
A
6.9
(1.1)
A
6.3
(0.5)
A
7
avr 3.2
(-2.1)
6.5
(1.4)
4.8
(-0.4)
2.3
(-3)
8
(3)
6.6
(1.5)
6
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 185005_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.66
Sequence Type Exemplar sequence
Representative Public ID F23C8.11 NCBI
Target Description F23C8.11 /REP_DB=WormBase Gene ID /WP=CE20719 /TR=Q9TXH6 /GB=AAD03133.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_058580(11), NM_073508(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_058580 NCBI Caenorhabditis elegans F23C8.11 (F23C8.11) mRNA, complete cds. 11/11 A 
NM_073508 NCBI Caenorhabditis elegans T11F9.7 (T11F9.7) mRNA, complete cds. 11/11 None
SNAP00000018143 ENSEMBL cdna:SNAP chromosome:CEL140:I:2449415:2450376:-1 11/11 None
F23C8.11 ENSEMBL cdna:known chromosome:CEL140:I:2449415:2451055:-1 gene:F23C8.11 11/11 A 
T11F9.7 ENSEMBL cdna:known chromosome:CEL140:V:11478500:11479494:1 gene:T11F9.7 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000013922 7/11 Cross Hyb Matching Probes None
GENEFINDER00000013941 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:2449414-2451055(-) 92.84 100.0
Public Domain and Genome References
Gene Title

Ensembl F23C8.11
T11F9.7
Entrez Gene 184893 Entrez gene
188424 Entrez gene
SwissProt Q9TXH6 EMBL-EBI
Q22399 EMBL-EBI
WormBase CE20719 Wormbase
CE06419 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAD03133 Hypothetical protein F23C8.11 [Caenorhabditis elegans] ref|NP_490981.1| F23C8.11 [Caenorhabditis elegans] 0.0
blast AAD03133 Hypothetical protein F23C8.11 [Caenorhabditis elegans] ref|NP_490981.1| F23C8.11 [Caenorhabditis elegans] 1.0E-128
blast CAA98531 Hypothetical protein T11F9.7 [Caenorhabditis elegans] ref|NP_505909.1| T11F9.7 [Caenorhabditis elegans] 1.0E-123
blast Q22398 Zinc metalloproteinase nas-22 precursor (Nematode astacin 22) 1.0E-104
blast CAA98531 Hypothetical protein T11F9.7 [Caenorhabditis elegans] ref|NP_505909.1| T11F9.7 [Caenorhabditis elegans] 9.0E-67
blast AAD03133 Hypothetical protein F23C8.11 [Caenorhabditis elegans] ref|NP_490981.1| F23C8.11 [Caenorhabditis elegans] 1.0E-66
Sequence
Target Sequence
>C. ELEGANS:185005_S_AT
gtgccgtcgtactgacaaacatttcaaggagcttccaagtggacttatcaatattattaa
agatctctctctggacatttctggattgtacctgcctcaaaccctattgacaggaaaaat
tgatctgaacgatgaattcgtcgcatcaattgaagtcgaggatgcagaaaaatcgaagga
aattctgcgacgacgaagggaaagaccgttggccttgaggcagttcagtcatgctctttc
aagagcaatggcgaatcttcgcacatatcattatgatgtgacgaccaagaagattgagcc
gtgtccaatgagatactcttgcaaaggacatttaaaatgggagcagatgcgaaaatatcg
agctcagtgcaagaagaatttcaaagaccctagcctg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTGCCGTCGTACTGACAAACATTTC 241 475 885 Antisense
GACAAACATTTCAAGGAGCTTCCAA 614 365 898 Antisense
GGAGCTTCCAAGTGGACTTATCAAT 414 519 912 Antisense
TTAAAGATCTCTCTCTGGACATTTC 597 683 941 Antisense
GGACATTTCTGGATTGTACCTGCCT 477 523 957 Antisense
ACCTGCCTCAAACCCTATTGACAGG 503 87 974 Antisense
TTCGTCGCATCAATTGAAGTCGAGG 615 695 1021 Antisense
GAGGCAGTTCAGTCATGCTCTTTCA 130 405 1101 Antisense
GCGAATCTTCGCACATATCATTATG 525 287 1135 Antisense
GAAAATATCGAGCTCAGTGCAAGAA 209 353 1235 Antisense
GAAGAATTTCAAAGACCCTAGCCTG 516 339 1257 Antisense
Sequence Source Affymetrix Proprietary Database