[Home] | [Total List]

[185004_at]

Description F23C8.11 /REP_DB=WormBase Gene ID /WP=CE20719 /TR=Q9TXH6 /GB=AAD03133.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 80      4grp_total > 18      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/185004_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 6
1 2 3 4 range
A 3.3
(-3)
A
6.4
(2.8)
A
3.3
(-3)
A
6.5
(3)
A
3
B 2.2
(-3)
A
3.2
(0.5)
A
3
(-0.2)
A
3.9
(3)
A
2
C 3.2
(-1.1)
A
1.2
(-3)
A
2
(-2.3)
A
7.6
(3)
A
6
avr 2.9
(-2.8)
3.6
(-1.5)
2.8
(-3)
6
(3)
3

Warning: fopen(./gnuplot/185004_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 9
1 2 3 4 5 6 range
A 9.8
(3)
A
2.1
(-2.9)
A
2
(-3)
A
2.9
(-2.3)
A
2.6
(-2.5)
A
2.5
(-2.6)
A
8
B 3.3
(-1.7)
A
1.7
(-2.7)
A
7.8
(1.3)
A
5.7
(-0.1)
A
10.4
(3)
A
1.3
(-3)
A
9
C 1.5
(-3)
A
1.9
(-2.5)
A
1.6
(-2.9)
A
6.5
(3)
A
2.4
(-1.9)
A
2.3
(-2)
A
5
avr 4.9
(2.6)
1.9
(-3)
3.8
(0.6)
5
(2.8)
5.1
(3)
2
(-2.8)
3
No Scale

Warning: fopen(./gnuplot/185004_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1
1 2 3 4 range
A 1.2
(1)
A
1.4
(3)
A
0.8
(-3)
A
0.9
(-2)
A
1
B 0.7
(-3)
A
0.8
(3)
A
0.7
(-3)
A
0.8
(3)
A
0
C 1
(1.2)
A
0.3
(-3)
A
0.7
(-0.6)
A
1.3
(3)
A
1
avr 1
(3)
0.8
(-1)
0.7
(-3)
1
(3)
0

Warning: fopen(./gnuplot/185004_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/185004_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4
1 2 3 4 5 6 range
A 1.8
(3)
A
0.7
(-1.7)
A
0.4
(-3)
A
0.7
(-1.7)
A
0.8
(-1.3)
A
0.6
(-2.1)
A
1
B 1.1
(-2)
A
0.6
(-2.8)
A
1.9
(-0.7)
A
1.5
(-1.4)
A
4.2
(3)
A
0.5
(-3)
A
4
C 0.6
(-1.7)
A
0.6
(-1.7)
A
0.4
(-3)
A
1.3
(3)
A
0.8
(-0.3)
A
0.8
(-0.3)
A
1
avr 1.2
(-0.2)
0.6
(-3)
0.9
(-1.6)
1.2
(-0.2)
1.9
(3)
0.6
(-3)
1
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 185004_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.66
Sequence Type Exemplar sequence
Representative Public ID F23C8.11 NCBI
Target Description F23C8.11 /REP_DB=WormBase Gene ID /WP=CE20719 /TR=Q9TXH6 /GB=AAD03133.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_058580(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_058580 NCBI Caenorhabditis elegans F23C8.11 (F23C8.11) mRNA, complete cds. 11/11 A 
SNAP00000018143 ENSEMBL cdna:SNAP chromosome:CEL140:I:2449415:2450376:-1 11/11 None
F23C8.11 ENSEMBL cdna:known chromosome:CEL140:I:2449415:2451055:-1 gene:F23C8.11 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:2449414-2451055(-) 92.84 100.0
Public Domain and Genome References
Gene Title
Ensembl F23C8.11
Entrez Gene 184893 Entrez gene
SwissProt Q9TXH6 EMBL-EBI
WormBase CE20719 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAD03133 Hypothetical protein F23C8.11 [Caenorhabditis elegans] ref|NP_490981.1| F23C8.11 [Caenorhabditis elegans] 0.0
blast AAD03133 Hypothetical protein F23C8.11 [Caenorhabditis elegans] ref|NP_490981.1| F23C8.11 [Caenorhabditis elegans] 1.0E-128
blast CAA98531 Hypothetical protein T11F9.7 [Caenorhabditis elegans] ref|NP_505909.1| T11F9.7 [Caenorhabditis elegans] 9.0E-67
blast CAA98531 Hypothetical protein T11F9.7 [Caenorhabditis elegans] ref|NP_505909.1| T11F9.7 [Caenorhabditis elegans] 2.0E-66
blast Q22398 Zinc metalloproteinase nas-22 precursor (Nematode astacin 22) 9.0E-52
blast Q22398 Zinc metalloproteinase nas-22 precursor (Nematode astacin 22) 2.0E-51
Sequence
Target Sequence
>C. ELEGANS:185004_AT
ggtcttataaaatctccggaatcgatgaatttctggactgtgatgcgcctaagttctaca
acgagacgaatctttccggtaaagattctttcgcgcaattgaccaatttctaccaacagc
ttcttccaatcatgatcacacccgtatataacatctggtgctacacatacagaccaaaat
cgtgccgtcgtactgacaaacatttcaaggagcttccaagtggacttatcaatattatta
aagatctctctctggacatttctggattgtacctgcctcaaaccctattgacaggaaaaa
ttgatctgaacgatgaattcgtcgcatcaattgaagtcgaggatgcagaaaaatcgaagg
aaattctgcgacgacgaagggaaagaccgttggccttgaggcagttcagtcatgctcttt
caagagcaatggcgaatcttcgcacatatcattatgatgtgacgaccaagaagattgagc
cgtgtccaatgagatactctt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGTCTTATAAAATCTCCGGAATCGA 314 503 704 Antisense
GAATTTCTGGACTGTGATGCGCCTA 156 325 730 Antisense
GATGCGCCTAAGTTCTACAACGAGA 182 415 745 Antisense
TACAACGAGACGAATCTTTCCGGTA 200 637 760 Antisense
AAAGATTCTTTCGCGCAATTGACCA 431 119 784 Antisense
TGACCAATTTCTACCAACAGCTTCT 72 571 803 Antisense
AACAGCTTCTTCCAATCATGATCAC 404 137 818 Antisense
GATCACACCCGTATATAACATCTGG 602 421 837 Antisense
ACATCTGGTGCTACACATACAGACC 217 107 854 Antisense
TACAGACCAAAATCGTGCCGTCGTA 387 643 871 Antisense
GAGCCGTGTCCAATGAGATACTCTT 25 387 1180 Antisense
Sequence Source Affymetrix Proprietary Database