[Home] | [Total List]

[184674_at]

Description H10D18.2 /REP_DB=WormBase Gene ID /WP=CE23800 /TR=Q9N5N3 /GB=AAF39874.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 4grp_high_8_8 > 06      6grp_total > 98      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/184674_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 6687
1 2 3 4 range
A 152.6
(-2.9)
P
84
(-3)
A
85.4
(-3)
A
5974
(3)
P
5890
B 161
(-2.9)
P
92.3
(-3)
M
60.7
(-3)
A
6748.1
(3)
P
6687
C 187.8
(-2.9)
P
117.1
(-2.9)
P
65.4
(-3)
P
5886.4
(3)
P
5821
avr 167.1
(-2.9)
97.8
(-3)
70.5
(-3)
6202.8
(3)
6132

Warning: fopen(./gnuplot/184674_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 27411
1 2 3 4 5 6 range
A 66.4
(-3)
A
59.7
(-3)
A
84.9
(-3)
P
1625.1
(-2.7)
P
14980.5
(0.3)
P
27463.9
(3)
P
27404
B 60.8
(-3)
A
53.1
(-3)
A
58.7
(-3)
A
1291.3
(-2.7)
P
15436.4
(0.8)
P
24456.1
(3)
P
24403
C 83.7
(-3)
M
71.1
(-3)
P
133.3
(-3)
P
1470.9
(-2.7)
P
16807.4
(1.1)
P
24618.6
(3)
P
24548
avr 70.3
(-3)
61.3
(-3)
92.3
(-3)
1462.4
(-2.7)
15741.4
(0.7)
25512.9
(3)
25452
No Scale

Warning: fopen(./gnuplot/184674_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1424
1 2 3 4 range
A 55.6
(-2.7)
P
18.2
(-3)
A
22.3
(-3)
A
874.5
(3)
P
856
B 51.3
(-2.8)
P
22.8
(-3)
M
14.1
(-3)
A
1438
(3)
P
1424
C 62.2
(-2.8)
P
33.7
(-2.9)
P
22.8
(-3)
P
992.5
(3)
P
970
avr 56.4
(-2.8)
24.9
(-3)
19.7
(-3)
1101.7
(3)
1082

Warning: fopen(./gnuplot/184674_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184674_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 9107
1 2 3 4 5 6 range
A 12.2
(-3)
A
21.2
(-3)
A
18.5
(-3)
P
412.2
(-2.6)
P
4520.5
(1.1)
P
6686.6
(3)
P
6674
B 21.2
(-3)
A
17.7
(-3)
A
14.2
(-3)
A
342
(-2.8)
P
6271.6
(1.1)
P
9119.6
(3)
P
9105
C 31
(-3)
M
21.7
(-3)
P
33.9
(-3)
P
295.8
(-2.8)
P
5438.6
(1)
P
8241.3
(3)
P
8220
avr 21.5
(-3)
20.2
(-3)
22.2
(-3)
350
(-2.8)
5410.2
(1)
8015.8
(3)
7996
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 184674_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15204
Sequence Type Exemplar sequence
Representative Public ID H10D18.2 NCBI
Target Description H10D18.2 /REP_DB=WormBase Gene ID /WP=CE23800 /TR=Q9N5N3 /GB=AAF39874.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071655(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071655 NCBI Caenorhabditis elegans H10D18.2 (H10D18.2) mRNA, complete cds. 11/11 None
SNAP00000043934 ENSEMBL cdna:SNAP chromosome:CEL140:V:3812409:3813176:1 11/11 None
GENEFINDER00000043940 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:3812409:3813176:1 10/11 None
H10D18.2 ENSEMBL cdna:known chromosome:CEL140:V:3812409:3813176:1 gene:H10D18.2 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:3812408-3813176(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl H10D18.2
Entrez Gene 186714 Entrez gene
SwissProt Q9N5N3 EMBL-EBI
WormBase CE23800 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5576 extracellular region inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF39874 Hypothetical protein H10D18.2 [Caenorhabditis elegans] ref|NP_504056.1| H10D18.2 [Caenorhabditis elegans] 1.0E-115
blast AAF39876 Hypothetical protein H10D18.4 [Caenorhabditis elegans] ref|NP_504055.1| H10D18.4 [Caenorhabditis elegans] 2.0E-86
blast AAF39874 Hypothetical protein H10D18.2 [Caenorhabditis elegans] ref|NP_504056.1| H10D18.2 [Caenorhabditis elegans] 7.0E-80
blast CAE58120 Hypothetical protein CBG01207 [Caenorhabditis briggsae] 2.0E-74
Protein Domains
Database ID Description E-Value
Pfam IPR001283 EMBL-EBI Allergen V5/Tpx-1 related 2.2E-66
Pfam IPR001283 EMBL-EBI Allergen V5/Tpx-1 related 6.3E-11
Pfam IPR001283 EMBL-EBI Allergen V5/Tpx-1 related 8.9E-27
Sequence
Target Sequence
>C. ELEGANS:184674_AT
atctttggatgcgcaacggctcaattcagctcgactgctcagactgcaattgtcaaggct
cataatgacctgagatctgcaattgctctcgggaactacgatgctgctggaactatcgag
ccacctgcagctaacatgcgaaaaattaaatgggattccactgtggcaagctctgctcaa
caatacgccaatacatgcccagacgatcattctggaactgaatacggagagaacctctat
tggtcctggtcctcttcggctccaaccagtcttgacaaatttggagttgctgcatcaaac
tcatgggaaaaggagttccaggattacggatgggagtccacatacatggatgctgacctc
ttcgactctggaatcggacatgctactcaaatggcgtgggctgaaactaacaagatcgga
tgtggtgttaagaattgcggaaaggattcttcaatgaacaatatgtacaaggtcgcagtg
gtatgccagtacgatcaagctggaaatatgatggattcggatatctaccagtctggagac
acttgctcgttctgtccatctggatcaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATCTTTGGATGCGCAACGGCTCAAT 29 33 40 Antisense
TCAGCTCGACTGCTCAGACTGCAAT 236 625 65 Antisense
ATCTGCAATTGCTCTCGGGAACTAC 354 31 114 Antisense
TGCTGCTGGAACTATCGAGCCACCT 313 581 141 Antisense
AGCCACCTGCAGCTAACATGCGAAA 682 83 158 Antisense
AATACGCCAATACATGCCCAGACGA 499 171 221 Antisense
CATACATGGATGCTGACCTCTTCGA 710 211 380 Antisense
GTCGCAGTGGTATGCCAGTACGATC 393 475 511 Antisense
GATTCGGATATCTACCAGTCTGGAG 598 431 553 Antisense
CAGTCTGGAGACACTTGCTCGTTCT 609 207 568 Antisense
GCTCGTTCTGTCCATCTGGATCAAA 221 299 584 Antisense
Sequence Source Affymetrix Proprietary Database