[Home] | [Total List]

[184000_at]

Description R05F9.7 /REP_DB=WormBase Gene ID /WP=CE04810 /TR=Q21741 /GB=AAA83162.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 54      4grp_total > 01      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/184000_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 73
1 2 3 4 range
A 4.7
(-2.9)
A
3.6
(-3)
A
3.1
(-3)
A
73.4
(3)
A
70
B 17.8
(0)
A
4.6
(-3)
A
26.7
(2)
A
31
(3)
A
26
C 6.6
(-3)
A
6.1
(-3)
A
18.4
(-2)
A
76.5
(3)
A
70
avr 9.7
(-2.5)
4.8
(-3)
16.1
(-1.8)
60.3
(3)
56

Warning: fopen(./gnuplot/184000_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 49
1 2 3 4 5 6 range
A 3.6
(-2.7)
A
18.2
(0.5)
A
29.9
(3)
A
3.8
(-2.7)
A
3.3
(-2.8)
A
2.2
(-3)
A
28
B 7.6
(-3)
A
20.6
(-1.2)
A
50.7
(3)
A
27
(-0.3)
A
18.7
(-1.5)
A
22.4
(-0.9)
A
43
C 6.1
(-2.5)
A
39.6
(3)
A
16.5
(-0.8)
A
20.5
(-0.1)
A
2.9
(-3)
A
25.8
(0.7)
A
37
avr 5.8
(-3)
26.1
(1.6)
32.4
(3)
17.1
(-0.5)
8.3
(-2.4)
16.8
(-0.5)
27
No Scale

Warning: fopen(./gnuplot/184000_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 12
1 2 3 4 range
A 1.7
(-2.5)
A
0.8
(-3)
A
0.8
(-3)
A
10.7
(3)
A
10
B 5.7
(2)
A
1.1
(-3)
A
6.2
(2.6)
A
6.6
(3)
A
6
C 2.2
(-2.8)
A
1.8
(-3)
A
6.4
(-0.5)
A
12.9
(3)
A
11
avr 3.2
(-1.7)
1.2
(-3)
4.5
(-0.8)
10.1
(3)
9

Warning: fopen(./gnuplot/184000_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/184000_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12
1 2 3 4 5 6 range
A 0.7
(-2.8)
A
6.5
(3)
A
6.5
(3)
A
1
(-2.5)
A
1
(-2.5)
A
0.5
(-3)
A
6
B 2.6
(-3)
A
6.9
(-0.3)
A
12.3
(3)
A
7.2
(-0.2)
A
7.6
(0.1)
A
8.3
(0.5)
A
10
C 2.3
(-2.3)
A
12.1
(3)
A
4.2
(-1.2)
A
4.1
(-1.3)
A
0.9
(-3)
A
8.6
(1.1)
A
11
avr 1.9
(-3)
8.5
(3)
7.7
(2.3)
4.1
(-1)
3.2
(-1.8)
5.8
(0.5)
7
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 184000_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4782
Sequence Type Exemplar sequence
Representative Public ID R05F9.7 NCBI
Target Description R05F9.7 /REP_DB=WormBase Gene ID /WP=CE04810 /TR=Q21741 /GB=AAA83162.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062484(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062484 NCBI Caenorhabditis elegans R05F9.7 (R05F9.7) mRNA, complete cds. 11/11 None
GENEFINDER00000043880 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:4886262:4888197:1 9/11 None
R05F9.7 ENSEMBL cdna:known chromosome:CEL140:II:4886262:4888197:1 gene:R05F9.7 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000043865 2/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4886259-4888195(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl R05F9.7
Entrez Gene 187617 Entrez gene
SwissProt Q21741 EMBL-EBI
WormBase CE04810 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast NP_494885 R05F9.7 [Caenorhabditis elegans] gb|AAA83162.1| Hypothetical protein R05F9.7 [Caenorhabditis elegans] 1.0E-141
blast CAE58993 Hypothetical protein CBG02266 [Caenorhabditis briggsae] 1.0E-108
blast NP_494885 R05F9.7 [Caenorhabditis elegans] gb|AAA83162.1| Hypothetical protein R05F9.7 [Caenorhabditis elegans] 2.0E-90
blast CAE58993 Hypothetical protein CBG02266 [Caenorhabditis briggsae] 2.0E-62
blast CAI46618 Hypothetical protein Y54G9A.10 [Caenorhabditis elegans] ref|NP_001022477.1| Serpentine Receptor, class E (epsilon) family member (sre-46) [Caenorhabditis elegans] 2.0E-11
Protein Domains
Database ID Description E-Value
Pfam IPR004151 EMBL-EBI C. elegans Sre G protein-coupled chemoreceptor 3.2E-13
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_494885.1 6 7-29,49-71,84-106,121-143,184-206,216-238
R05F9.7 6 7-29,49-71,84-106,121-143,184-206,216-238
GENEFINDER00000043880 7 7-29,49-71,84-103,118-140,161-183,188-210,271-293
Sequence
Target Sequence
>C. ELEGANS:184000_AT
atatctatttttgctcttcacgactttatatatttttggaagtctggccagattctacat
gattttggttcaattaaagtttgtcacagttgaagcttctttgttgtatattattctatt
cgcatcactatgggcagttttctcaaacattgttttaatgtgcctttactattataatgt
acaagaatccaagagattatcatggaaagctgagaatcttcggaaaatgaaaaatgtaaa
ttatacattgagcaagaagtttcaagttgaagaaaatgtgaaaattattaaatatctgca
agttatgagctccatgttggtttttctcatattttttgttattatatttattgtagttcc
tagagtatatctgggttcaaaaacatattcgggtcaagttatgatttcactttttgatat
taatttggcacttggtgcaattctaattccttccgtttgcgttttacatttacggaaaac
tagagatatgccattttctgggaaaatccattgtttgaataagagacgcgatgaccgtca
ggtgaacccgattactgtatttga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATATCTATTTTTGCTCTTCACGACT 365 19 261 Antisense
GCTCTTCACGACTTTATATATTTTT 259 301 273 Antisense
AAGTCTGGCCAGATTCTACATGATT 357 157 300 Antisense
CACAGTTGAAGCTTCTTTGTTGTAT 598 195 345 Antisense
TATTATTCTATTCGCATCACTATGG 305 663 369 Antisense
GCATCACTATGGGCAGTTTTCTCAA 546 307 382 Antisense
GAGCTCCATGTTGGTTTTTCTCATA 367 387 567 Antisense
GGCACTTGGTGCAATTCTAATTCCT 608 533 687 Antisense
GCAATTCTAATTCCTTCCGTTTGCG 167 323 697 Antisense
GACGCGATGACCGTCAGGTGAACCC 134 379 785 Antisense
AGGTGAACCCGATTACTGTATTTGA 257 57 800 Antisense
Sequence Source Affymetrix Proprietary Database