[Home] | [Total List]

[183721_at]

Description F17E9.4 /REP_DB=WormBase Gene ID /WP=CE27971 /TR=O61522 /GB=AAC05104.2 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Cluster 6grp_total > 94      4grp_total > 0      6grp_total_sub > Hat      6grp_rule_based > S5      

Scale

Warning: fopen(./gnuplot/183721_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 66
1 2 3 4 range
A 22.3
(-1)
A
6.5
(-3)
A
45.7
(1.8)
P
55.1
(3)
A
49
B 25.8
(-0.3)
A
1.9
(-3)
A
28.3
(-0)
A
55.3
(3)
P
53
C 1.3
(-3)
A
0.9
(-3)
A
16.6
(-1.6)
A
66.6
(3)
A
66
avr 16.5
(-1.6)
3.1
(-3)
30.2
(-0.1)
59
(3)
56

Warning: fopen(./gnuplot/183721_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 696
1 2 3 4 5 6 range
A 5.4
(-3)
A
4.2
(-3)
A
10.8
(-2.9)
A
30.1
(-2.8)
A
669.8
(3)
P
280.5
(-0.5)
P
666
B 16.8
(-2.9)
A
14.6
(-2.9)
A
1.5
(-3)
A
26
(-2.8)
P
697.9
(3)
P
366.9
(0.1)
P
696
C 15.5
(-2.9)
A
42.5
(-2.6)
A
1.8
(-3)
A
49.8
(-2.5)
A
625
(3)
P
385.8
(0.7)
P
623
avr 12.6
(-2.9)
20.4
(-2.9)
4.7
(-3)
35.3
(-2.7)
664.2
(3)
344.4
(0.1)
660
No Scale

Warning: fopen(./gnuplot/183721_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 12
1 2 3 4 range
A 8.1
(0.8)
A
1.4
(-3)
A
11.9
(3)
P
8.1
(0.8)
A
11
B 8.2
(1.1)
A
0.5
(-3)
A
6.6
(0.2)
A
11.8
(3)
P
11
C 0.4
(-2.9)
A
0.3
(-3)
A
5.8
(0)
A
11.2
(3)
A
11
avr 5.6
(0)
0.7
(-3)
8.1
(1.6)
10.4
(3)
10

Warning: fopen(./gnuplot/183721_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183721_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 283
1 2 3 4 5 6 range
A 1
(-3)
A
1.5
(-3)
A
2.3
(-3)
A
7.6
(-2.8)
A
202.1
(3)
P
68.3
(-1)
P
201
B 5.8
(-2.9)
A
4.9
(-2.9)
A
0.4
(-3)
A
6.9
(-2.9)
P
283.5
(3)
P
136.8
(-0.1)
P
283
C 5.7
(-2.8)
A
13
(-2.6)
A
0.5
(-3)
A
10
(-2.7)
A
202.2
(3)
P
129.1
(0.8)
P
202
avr 4.2
(-2.9)
6.5
(-2.9)
1.1
(-3)
8.2
(-2.8)
229.3
(3)
111.4
(-0.1)
228
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 183721_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8725
Sequence Type Exemplar sequence
Representative Public ID F17E9.4 NCBI
Target Description F17E9.4 /REP_DB=WormBase Gene ID /WP=CE27971 /TR=O61522 /GB=AAC05104.2 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069012(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069012 NCBI Caenorhabditis elegans F17E9.4 (F17E9.4) mRNA, complete cds. 11/11 None
GENEFINDER00000000496 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8348369:8349075:1 11/11 None
F17E9.4 ENSEMBL cdna:known chromosome:CEL140:IV:8348369:8349077:1 gene:F17E9.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000000488 2/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:8348374-8349081(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl F17E9.4
Entrez Gene 177630 Entrez gene
SwissProt O61522 EMBL-EBI
WormBase CE27971 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAC05104 Hypothetical protein F17E9.4 [Caenorhabditis elegans] ref|NP_501413.1| F17E9.4 [Caenorhabditis elegans] 1.0E-79
blast NP_501417 D2096.5 [Caenorhabditis elegans] gb|AAA81489.2| Hypothetical protein D2096.5 [Caenorhabditis elegans] 2.0E-19
blast NP_501425 D2096.10 [Caenorhabditis elegans] gb|AAA81497.2| Hypothetical protein D2096.10 [Caenorhabditis elegans] 1.0E-18
Protein Domains
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_501413.1 1 4-26
F17E9.4 1 4-26
GENEFINDER00000000496 1 4-26
Sequence
Target Sequence
>C. ELEGANS:183721_AT
gacgggattctcaagtgtattcctaagcattcttttttgtattttcttcccatacgttgt
ctattcggccagttctacaaaattcaatttctctggaacaatcacatgtaatgccaccat
gaaagattcatttgtcgagaagctgcaagtatg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GACGGGATTCTCAAGTGTATTCCTA 247 377 15 Antisense
GATTCTCAAGTGTATTCCTAAGCAT 444 431 20 Antisense
GTATTCCTAAGCATTCTTTTTTGTA 135 453 31 Antisense
TTTTGTATTTTCTTCCCATACGTTG 18 679 49 Antisense
TGTATTTTCTTCCCATACGTTGTCT 593 559 52 Antisense
TTGTCTATTCGGCCAGTTCTACAAA 538 707 71 Antisense
TTCGGCCAGTTCTACAAAATTCAAT 655 687 78 Antisense
GGAACAATCACATGTAATGCCACCA 295 529 109 Antisense
TGTAATGCCACCATGAAAGATTCAT 698 557 121 Antisense
AAGATTCATTTGTCGAGAAGCTGCA 518 155 137 Antisense
CATTTGTCGAGAAGCTGCAAGTATG 684 213 143 Antisense
Sequence Source Affymetrix Proprietary Database