[Home] | [Total List]

[183384_at]

Description Y70C5C.5 /REP_DB=WormBase Gene ID /WP=CE16677 /TR=O62501 /GB=CAB16539.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 71      4grp_total > 05      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/183384_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 91
1 2 3 4 range
A 54.8
(0.5)
A
2.2
(-3)
A
28.9
(-1.2)
A
93
(3)
A
91
B 3
(-2.6)
A
2.6
(-2.7)
A
24.9
(3)
A
1.6
(-3)
A
23
C 12.2
(-2.3)
A
4.4
(-2.9)
A
2.8
(-3)
A
80.7
(3)
A
78
avr 23.3
(-0.8)
3.1
(-3)
18.9
(-1.3)
58.4
(3)
55

Warning: fopen(./gnuplot/183384_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 78
1 2 3 4 5 6 range
A 28
(-0)
A
18.1
(-2.7)
A
20.5
(-2)
A
17
(-3)
A
39.1
(3)
A
17.3
(-2.9)
A
22
B 34.6
(0.4)
A
35.1
(0.5)
A
55.8
(2.8)
A
57.7
(3)
A
39.4
(0.9)
A
4.2
(-3)
A
54
C 4.2
(-3)
A
44.9
(0.1)
A
24.5
(-1.4)
A
82.6
(3)
A
15.5
(-2.1)
A
46.9
(0.3)
A
78
avr 22.3
(-3)
32.7
(-0.9)
33.6
(-0.7)
52.4
(3)
31.3
(-1.2)
22.8
(-2.9)
30
No Scale

Warning: fopen(./gnuplot/183384_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 20
1 2 3 4 range
A 20
(3)
A
0.5
(-3)
A
7.5
(-0.8)
A
13.6
(1)
A
20
B 1
(-2.2)
A
0.6
(-2.7)
A
5.8
(3)
A
0.3
(-3)
A
6
C 4
(-1.6)
A
1.3
(-2.9)
A
1
(-3)
A
13.6
(3)
A
13
avr 8.3
(2.4)
0.8
(-3)
4.8
(-0.1)
9.2
(3)
8

Warning: fopen(./gnuplot/183384_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183384_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 15
1 2 3 4 5 6 range
A 5.2
(-2.2)
A
6.4
(-1.3)
A
4.5
(-2.8)
A
4.3
(-2.9)
A
11.8
(3)
A
4.2
(-3)
A
8
B 12
(1.3)
A
11.7
(1.2)
A
13.6
(2)
A
15.3
(2.7)
A
16
(3)
A
1.6
(-3)
A
14
C 1.6
(-3)
A
13.7
(1.8)
A
6.2
(-1.2)
A
16.6
(3)
A
5
(-1.6)
A
15.7
(2.6)
A
15
avr 6.3
(-3)
10.6
(1.4)
8.1
(-1.1)
12.1
(3)
10.9
(1.8)
7.2
(-2.1)
6
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 183384_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13201
Sequence Type Exemplar sequence
Representative Public ID Y70C5C.5 NCBI
Target Description Y70C5C.5 /REP_DB=WormBase Gene ID /WP=CE16677 /TR=O62501 /GB=CAB16539.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074829(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074829 NCBI Caenorhabditis elegans Y70C5C.5 (Y70C5C.5) mRNA, complete cds. 11/11 None
SNAP00000034983 ENSEMBL cdna:SNAP chromosome:CEL140:V:16720324:16723496:1 11/11 None
GENEFINDER00000034987 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:16720999:16724574:1 11/11 None
Y70C5C.5 ENSEMBL cdna:known chromosome:CEL140:V:16720999:16723496:1 gene:Y70C5C.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:16720998-16723496(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y70C5C.5
Entrez Gene 190570 Entrez gene
SwissProt O62501 EMBL-EBI
WormBase CE38251 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAB16539 Hypothetical protein Y70C5C.5 [Caenorhabditis elegans] ref|NP_507230.2| Y70C5C.5 [Caenorhabditis elegans] 0.0
blast CAB05791 Hypothetical protein T08G3.4 [Caenorhabditis elegans] ref|NP_507158.1| T08G3.4 [Caenorhabditis elegans] 1.0E-174
blast CAB05791 Hypothetical protein T08G3.4 [Caenorhabditis elegans] ref|NP_507158.1| T08G3.4 [Caenorhabditis elegans] 1.0E-166
blast CAB05791 Hypothetical protein T08G3.4 [Caenorhabditis elegans] ref|NP_507158.1| T08G3.4 [Caenorhabditis elegans] 1.0E-165
blast CAB05791 Hypothetical protein T08G3.4 [Caenorhabditis elegans] ref|NP_507158.1| T08G3.4 [Caenorhabditis elegans] 1.0E-162
blast AAT48616 Hypothetical protein F47F6.5 [Caenorhabditis elegans] ref|NP_493933.2| F47F6.5 [Caenorhabditis elegans] 1.0E-118
blast AAT48616 Hypothetical protein F47F6.5 [Caenorhabditis elegans] ref|NP_493933.2| F47F6.5 [Caenorhabditis elegans] 1.0E-115
Protein Domains
Trans Membrane
ID Number Of Domains Domain Boundaries
SNAP00000034983 1 13-35
Sequence
Target Sequence
>C. ELEGANS:183384_AT
tcactcaacgctcgctgatcaagaacacaggtggaccgactcagtacggcgatgagattg
aaaagttcgacacgagtgagctcaatgagaaatgcaagcttctcgggaacattctcaatg
tggacagcattccgatggttccgactgaaaacgagcaaaattacgtcaaacatcttctca
ccgatcatcaattctacatgacaagtggatttaagagcgatggctgtggaagaggggact
accgtactcaacaagatggaaatacttctacttcatttgattcaatcggttcgaacgatg
aatattgccatgctcacagaaacggacgttatcctacaatggctgcaatgcgagctcctg
ctatttgtgcaatgcacgaattcagttggtcgcatggggactgtgatccaaagccagaat
gggctgaagaaatgttggtatacaaccggacgagcgaatcagttttctgtca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCACTCAACGCTCGCTGATCAAGAA 349 627 848 Antisense
AGGTGGACCGACTCAGTACGGCGAT 600 55 876 Antisense
AGCTTCTCGGGAACATTCTCAATGT 95 79 944 Antisense
TGGACAGCATTCCGATGGTTCCGAC 583 547 968 Antisense
AATTACGTCAAACATCTTCTCACCG 665 175 1006 Antisense
TCTTCTCACCGATCATCAATTCTAC 454 617 1020 Antisense
AGGGGACTACCGTACTCAACAAGAT 705 53 1080 Antisense
GAATATTGCCATGCTCACAGAAACG 58 327 1147 Antisense
GGACGTTATCCTACAATGGCTGCAA 577 523 1171 Antisense
GTTGGTCGCATGGGGACTGTGATCC 612 435 1232 Antisense
GGACGAGCGAATCAGTTTTCTGTCA 15 525 1295 Antisense
Sequence Source Affymetrix Proprietary Database