[Home] | [Total List]

[183155_at]

Description D2096.1 /REP_DB=WormBase Gene ID /WP=CE04299 /TR=Q19012 /GB=AAA81499.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Cluster 6grp_high1_10_10 > 76      4grp_high_8_8 > 14      6grp_total > 77      4grp_total > 17      6grp_high1_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/183155_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1094
1 2 3 4 range
A 103.7
(-3)
A
324.5
(-1.8)
P
226.2
(-2.3)
P
1197.3
(3)
P
1094
B 177.2
(-3)
P
385.4
(-1.3)
P
334.3
(-1.7)
P
897.7
(3)
P
721
C 233.8
(-3)
P
292.2
(-0.9)
P
293.5
(-0.8)
P
400
(3)
P
166
avr 171.6
(-3)
334
(-1.5)
284.7
(-2)
831.7
(3)
660

Warning: fopen(./gnuplot/183155_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 374
1 2 3 4 5 6 range
A 167
(-3)
A
188.7
(-2.4)
P
216
(-1.7)
P
214.4
(-1.8)
P
192.5
(-2.3)
P
398.6
(3)
P
232
B 171.3
(-2.7)
P
153.5
(-3)
P
202.7
(-2.1)
P
196.4
(-2.3)
P
198.8
(-2.2)
P
499
(3)
P
346
C 125
(-3)
A
218.3
(-0.7)
P
129.6
(-2.9)
A
173.7
(-1.8)
P
188.5
(-1.5)
P
371.5
(3)
P
247
avr 154.4
(-3)
186.8
(-2.3)
182.8
(-2.4)
194.8
(-2.1)
193.3
(-2.1)
423
(3)
269
No Scale

Warning: fopen(./gnuplot/183155_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 154
1 2 3 4 range
A 37.8
(-3)
A
70.4
(-1.6)
P
59.1
(-2.1)
P
175.3
(3)
P
138
B 56.5
(-3)
P
95.2
(-1.3)
P
77.5
(-2.1)
P
191.3
(3)
P
135
C 77.4
(-1.3)
P
84
(-0.1)
P
102.3
(3)
P
67.4
(-3)
P
35
avr 57.2
(-3)
83.2
(-1.2)
79.6
(-1.5)
144.7
(3)
87

Warning: fopen(./gnuplot/183155_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/183155_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 155
1 2 3 4 5 6 range
A 30.8
(-3)
A
67.1
(0.3)
P
47
(-1.5)
P
54.4
(-0.9)
P
58.1
(-0.5)
P
97
(3)
P
66
B 59.6
(-2.5)
P
51.1
(-2.9)
P
49.2
(-3)
P
52
(-2.9)
P
80.8
(-1.6)
P
186.1
(3)
P
137
C 46.3
(-2.1)
A
66.6
(-0.8)
P
33
(-3)
A
34.9
(-2.9)
P
61
(-1.2)
P
124.4
(3)
P
91
avr 45.6
(-2.8)
61.6
(-1.8)
43.1
(-3)
47.1
(-2.7)
66.6
(-1.5)
135.8
(3)
93
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 183155_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.10221
Sequence Type Exemplar sequence
Representative Public ID D2096.1 NCBI
Target Description D2096.1 /REP_DB=WormBase Gene ID /WP=CE04299 /TR=Q19012 /GB=AAA81499.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069026(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069026 NCBI Caenorhabditis elegans D2096.1 (D2096.1) mRNA, complete cds. 11/11 None
SNAP00000025679 ENSEMBL cdna:SNAP chromosome:CEL140:IV:8396627:8397774:1 11/11 None
GENEFINDER00000025687 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8396630:8398419:1 11/11 None
D2096.1 ENSEMBL cdna:known chromosome:CEL140:IV:8396645:8398419:1 gene:D2096.1 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:8396650-8398425(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl D2096.1
Entrez Gene 183965 Entrez gene
SwissProt Q19012 EMBL-EBI
WormBase CE04299 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast NP_501427 D2096.1 [Caenorhabditis elegans] gb|AAA81499.1| Hypothetical protein D2096.1 [Caenorhabditis elegans] 7.0E-84
blast NP_501427 D2096.1 [Caenorhabditis elegans] gb|AAA81499.1| Hypothetical protein D2096.1 [Caenorhabditis elegans] 8.0E-84
blast NP_501427 D2096.1 [Caenorhabditis elegans] gb|AAA81499.1| Hypothetical protein D2096.1 [Caenorhabditis elegans] 1.0E-67
blast AAB92039 Hypothetical protein E04A4.5 [Caenorhabditis elegans] ref|NP_500627.1| E04A4.5 [Caenorhabditis elegans] sp|O44477|TIM17_CAEEL Probable mitochondrial import inner membrane translocase subunit Tim17 9.0E-23
blast CAE58576 Hypothetical protein CBG01742 [Caenorhabditis briggsae] 1.0E-22
blast AAB92039 Hypothetical protein E04A4.5 [Caenorhabditis elegans] ref|NP_500627.1| E04A4.5 [Caenorhabditis elegans] sp|O44477|TIM17_CAEEL Probable mitochondrial import inner membrane translocase subunit Tim17 6.0E-22
blast CAE58576 Hypothetical protein CBG01742 [Caenorhabditis briggsae] 8.0E-22
blast CAE58576 Hypothetical protein CBG01742 [Caenorhabditis briggsae] 4.0E-19
blast AAB92039 Hypothetical protein E04A4.5 [Caenorhabditis elegans] ref|NP_500627.1| E04A4.5 [Caenorhabditis elegans] sp|O44477|TIM17_CAEEL Probable mitochondrial import inner membrane translocase subunit Tim17 4.0E-19
Protein Domains
Database ID Description E-Value
Pfam IPR003397 EMBL-EBI Mitochondrial import inner membrane translocase, subunit Tim17/22 3.7E-18
Pfam IPR003397 EMBL-EBI Mitochondrial import inner membrane translocase, subunit Tim17/22 6.5E-20
Pfam IPR003397 EMBL-EBI Mitochondrial import inner membrane translocase, subunit Tim17/22 1.5E-19
Sequence
Target Sequence
>C. ELEGANS:183155_AT
aagactccatcaactctatcgtttctggaggattgactggagctctgttggctatccgtt
caccaaagatggaaaggattcgtctcgaagtcatagaacttggcgaacttatgggatatg
tccatttgcagaaaaaagtcccaaaagctcatgtcaattcacttctaattcttatcgaca
cgttatcaattcgagcgatcgatgttaaagacacactcgcagaatcagatatcgaggagt
tcaattcagtagttgaagaggttcttgccgccatgcgtagagactgtttgacaatgccac
aacgtg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AAGACTCCATCAACTCTATCGTTTC 442 153 104 Antisense
TTGACTGGAGCTCTGTTGGCTATCC 14 705 136 Antisense
GTTGGCTATCCGTTCACCAAAGATG 598 435 150 Antisense
GAACTTGGCGAACTTATGGGATATG 388 349 199 Antisense
GTCCCAAAAGCTCATGTCAATTCAC 502 475 241 Antisense
CTTCTAATTCTTATCGACACGTTAT 365 219 265 Antisense
GACACGTTATCAATTCGAGCGATCG 667 367 280 Antisense
AGACACACTCGCAGAATCAGATATC 68 73 312 Antisense
GTAGTTGAAGAGGTTCTTGCCGCCA 141 457 352 Antisense
GTTCTTGCCGCCATGCGTAGAGACT 51 445 364 Antisense
GACTGTTTGACAATGCCACAACGTG 498 375 385 Antisense
Sequence Source Affymetrix Proprietary Database