[Home] | [Total List]

[182852_at]

Description F57F4.2 /REP_DB=WormBase Gene ID /WP=CE11340 /TR=Q94244 /GB=AAB09165.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 78      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/182852_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 28725
1 2 3 4 range
A 80
(-3)
P
47.9
(-3)
A
44.1
(-3)
A
28729
(3)
P
28685
B 92.1
(-3)
M
4.3
(-3)
A
8
(-3)
A
23664.6
(3)
P
23660
C 65.2
(-3)
A
9
(-3)
A
27.4
(-3)
A
25292.8
(3)
P
25284
avr 79.1
(-3)
20.4
(-3)
26.5
(-3)
25895.5
(3)
25875

Warning: fopen(./gnuplot/182852_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 21347
1 2 3 4 5 6 range
A 6.2
(-3)
A
2.7
(-3)
A
23.1
(-3)
A
153.5
(-3)
P
7118.3
(-1)
P
21349.7
(3)
P
21347
B 21.1
(-3)
A
11.7
(-3)
A
39.3
(-3)
A
250.2
(-2.9)
P
9672.1
(-0.2)
P
20850.3
(3)
P
20839
C 4.2
(-3)
A
31
(-3)
A
4.2
(-3)
A
192.3
(-2.9)
P
8463.6
(-0.5)
P
19964.6
(3)
P
19960
avr 10.5
(-3)
15.1
(-3)
22.2
(-3)
198.7
(-2.9)
8418
(-0.6)
20721.5
(3)
20711
No Scale

Warning: fopen(./gnuplot/182852_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5042
1 2 3 4 range
A 29.1
(-3)
P
10.4
(-3)
A
11.5
(-3)
A
4205.4
(3)
P
4195
B 29.4
(-3)
M
1.1
(-3)
A
1.9
(-3)
A
5042.9
(3)
P
5042
C 21.6
(-3)
A
2.6
(-3)
A
9.6
(-3)
A
4264.8
(3)
P
4262
avr 26.7
(-3)
4.7
(-3)
7.7
(-3)
4504.4
(3)
4500

Warning: fopen(./gnuplot/182852_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182852_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 7774
1 2 3 4 5 6 range
A 1.2
(-3)
A
0.9
(-3)
A
5
(-3)
A
38.9
(-3)
P
2148
(-0.5)
P
5198
(3)
P
5197
B 7.3
(-3)
A
3.9
(-3)
A
9.6
(-3)
A
66.3
(-3)
P
3929.7
(0)
P
7775
(3)
P
7771
C 1.5
(-3)
A
9.5
(-3)
A
1.1
(-3)
A
38.7
(-3)
P
2738.7
(-0.5)
P
6683.3
(3)
P
6682
avr 3.3
(-3)
4.8
(-3)
5.2
(-3)
48
(-3)
2938.8
(-0.3)
6552.1
(3)
6549
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 182852_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12450
Sequence Type Exemplar sequence
Representative Public ID F57F4.2 NCBI
Target Description F57F4.2 /REP_DB=WormBase Gene ID /WP=CE11340 /TR=Q94244 /GB=AAB09165.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072223(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_072223 NCBI Caenorhabditis elegans F57F4.2 (F57F4.2) mRNA, complete cds. 11/11 None
F57F4.2 ENSEMBL cdna:known chromosome:CEL140:V:6389144:6392328:-1 gene:F57F4.2 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000021866 7/11 Cross Hyb Matching Probes None
GENEFINDER00000021873 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:6389143-6392328(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl F57F4.2
Entrez Gene 186454 Entrez gene
SwissProt Q94244 EMBL-EBI
WormBase CE11340 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAB09165 Hypothetical protein F57F4.2 [Caenorhabditis elegans] ref|NP_504624.1| F57F4.2 [Caenorhabditis elegans] 1.0E-131
Protein Domains
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_504624.1 1 252-274
F57F4.2 1 252-274
Sequence
Target Sequence
>C. ELEGANS:182852_AT
gagggagagggatctggtaaccaggatgggtcatccgatcatcccgatgaagaaaagaaa
ggaaatccattgtcaaagcatggagatggaggagaaggatctggaggccagaagttgcta
aaaaagagtgatggagatgatggaggttatggagaaggtgggccaccaaagcataacaaa
atcttccgcaaagccgcctcagttgctcattaccacaagaatggaaaatccgtattccgt
gcgtcccgtaatggaccgcatcgtgtgattgcaaccaaaaatgaatttctaaaatcacac
attcattctaaattaagaaatctcatgtgcatgttgcactttttcatagtaatgcactac
ataaaaattttgaagtttgtgcttattgcaattttccaatcgtatattcaatttctaaaa
aaaaccaaatatattttgtataattgctaccttacaattttgacatttaagaatttcaga
gaatttgaaattgtatcatcatacaccactatacaaacttcgaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GAGGGAGAGGGATCTGGTAACCAGG 326 401 427 Antisense
CAGGATGGGTCATCCGATCATCCCG 57 209 448 Antisense
GGTGGGCCACCAAAGCATAACAAAA 448 499 583 Antisense
TAACAAAATCTTCCGCAAAGCCGCC 86 635 600 Antisense
TGGAAAATCCGTATTCCGTGCGTCC 53 547 648 Antisense
TATTCCGTGCGTCCCGTAATGGACC 451 659 659 Antisense
GGACCGCATCGTGTGATTGCAACCA 249 523 679 Antisense
GTGCATGTTGCACTTTTTCATAGTA 254 481 753 Antisense
GTGCTTATTGCAATTTTCCAATCGT 544 479 805 Antisense
TTGCTACCTTACAATTTTGACATTT 535 693 870 Antisense
ATACACCACTATACAAACTTCGAAA 423 23 927 Antisense
Sequence Source Affymetrix Proprietary Database