[Home] | [Total List]

[182545_at]

Description C03E10.5 /REP_DB=WormBase Gene ID /WP=CE15585 /TR=O17562 /GB=CAB03824.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 99      4grp_total > 0      6grp_total_sub > Increase      

Scale

Warning: fopen(./gnuplot/182545_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 47
1 2 3 4 range
A 5
(-2.5)
A
1.4
(-3)
A
30.3
(0.7)
A
48.8
(3)
A
47
B 2.1
(-3)
A
2.1
(-3)
A
6.6
(3)
A
2.9
(-1.9)
A
5
C 4.5
(-3)
A
5.7
(-2.8)
A
14.3
(-1.7)
A
48.5
(3)
A
44
avr 3.9
(-2.8)
3.1
(-3)
17.1
(-0.2)
33.4
(3)
30

Warning: fopen(./gnuplot/182545_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 94
1 2 3 4 5 6 range
A 32.8
(-0.7)
A
15.7
(-2)
A
4.8
(-2.9)
A
3.2
(-3)
A
61.2
(1.4)
P
81.8
(3)
P
79
B 34.4
(-0.3)
A
5.6
(-2.9)
A
13.2
(-2.2)
A
4.9
(-3)
A
64.5
(2.4)
P
70.6
(3)
P
66
C 4.5
(-3)
A
7.1
(-2.8)
A
6.8
(-2.9)
A
9.1
(-2.7)
A
61.9
(0.7)
P
97.1
(3)
P
93
avr 23.9
(-1.6)
9.5
(-2.7)
8.3
(-2.8)
5.7
(-3)
62.5
(1.4)
83.2
(3)
78
No Scale

Warning: fopen(./gnuplot/182545_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8
1 2 3 4 range
A 1.8
(-1.8)
A
0.3
(-3)
A
7.9
(3)
A
7.1
(2.4)
A
8
B 0.7
(-1.8)
A
0.5
(-3)
A
1.5
(3)
A
0.6
(-2.4)
A
1
C 1.5
(-3)
A
1.6
(-2.9)
A
5
(0.1)
A
8.2
(3)
A
7
avr 1.3
(-2.3)
0.8
(-3)
4.8
(2.3)
5.3
(3)
5

Warning: fopen(./gnuplot/182545_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182545_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 32
1 2 3 4 5 6 range
A 6
(-1.4)
A
5.6
(-1.5)
A
1
(-2.9)
A
0.8
(-3)
A
18.5
(2.6)
P
19.9
(3)
P
19
B 12
(-0.4)
A
1.9
(-2.9)
A
3.2
(-2.5)
A
1.3
(-3)
A
26.2
(3)
P
26.3
(3)
P
25
C 1.7
(-3)
A
2.2
(-2.9)
A
1.7
(-3)
A
1.8
(-3)
A
20
(0.6)
P
32.5
(3)
P
31
avr 6.6
(-1.7)
3.2
(-2.5)
2
(-2.8)
1.3
(-3)
21.6
(1.9)
26.2
(3)
25
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 182545_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14447
Sequence Type Exemplar sequence
Representative Public ID C03E10.5 NCBI
Target Description C03E10.5 /REP_DB=WormBase Gene ID /WP=CE15585 /TR=O17562 /GB=CAB03824.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073462(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_073462 NCBI Caenorhabditis elegans C03E10.5 (C03E10.5) mRNA, complete cds. 11/11 None
SNAP00000008149 ENSEMBL cdna:SNAP chromosome:CEL140:V:11275736:11279879:1 9/11 None
GENEFINDER00000008163 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:11272340:11279879:1 9/11 None
C03E10.5 ENSEMBL cdna:known chromosome:CEL140:V:11277637:11280722:1 gene:C03E10.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:11277636-11280656(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl C03E10.5
Entrez Gene 179561 Entrez gene
SwissProt O17562 EMBL-EBI
WormBase CE15585 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5529 sugar binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03824 Hypothetical protein C03E10.5 [Caenorhabditis elegans] ref|NP_505863.1| C03E10.5 [Caenorhabditis elegans] 0.0
blast CAE75209 Hypothetical protein CBG23156 [Caenorhabditis briggsae] 1.0E-177
blast CAE75209 Hypothetical protein CBG23156 [Caenorhabditis briggsae] 1.0E-166
blast CAB03826 Hypothetical protein F07B10.3 [Caenorhabditis elegans] emb|CAB01142.2| Hypothetical protein F07B10.3 [Caenorhabditis elegans] ref|NP_505861.2| Seven TM Receptor family member (str-115) [Caenorhabditis elegans] 7.0E-53
Protein Domains
Database ID Description E-Value
Pfam IPR003002 EMBL-EBI 7TM chemoreceptor, subfamily 1 8.1E-21
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.8E-4
Trans Membrane
ID Number Of Domains Domain Boundaries
GENEFINDER00000008163 4 24-46,67-89,109-131,138-155
Sequence
Target Sequence
>C. ELEGANS:182545_AT
tccactacaactgctacaacatcaatgagtacaacaaaaaaagtatgcgctaaaagtgac
ctaaaatgtgcaaatggctggacttcatttaatcggacgagtacaaacccattctgtttt
aaagttatcagcagctacaatcaatcgtatgagcaatcagaagcactttgtgcagcgagc
ggtggatatctttctggagttgaaaatataacggaataccagtttgctgttgaattagca
aaagcagctgttgattattcaacaagtttcaatgaaaaaatcctggtgacaattgcatta
aaaagaaaagttatttgcttacaaacagactctactgaatcatgtataacatttaaggcc
tatgaattcgtcgatgacaaaacaaaatatgttgcgattcttcaacattatagtctctgg
gctgataatcaacctgttataatttccgatcaaccccatggatgtgttggaataatggtt
actcaaagcacaagtacatcaggagattcaaaattgttttcaacgagatgtgagacgggt
acccaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCCACTACAACTGCTACAACATCAA 685 587 1279 Antisense
GGCTGGACTTCATTTAATCGGACGA 256 541 1354 Antisense
ATCGGACGAGTACAAACCCATTCTG 269 33 1370 Antisense
AGCACTTTGTGCAGCGAGCGGTGGA 342 77 1440 Antisense
GAGCGGTGGATATCTTTCTGGAGTT 288 387 1455 Antisense
ATTTGCTTACAAACAGACTCTACTG 237 17 1591 Antisense
AAGGCCTATGAATTCGTCGATGACA 638 161 1633 Antisense
GCGATTCTTCAACATTATAGTCTCT 423 289 1672 Antisense
TAGTCTCTGGGCTGATAATCAACCT 594 653 1689 Antisense
AATTTCCGATCAACCCCATGGATGT 26 175 1719 Antisense
ACGAGATGTGAGACGGGTACCCAAA 706 89 1801 Antisense
Sequence Source Affymetrix Proprietary Database