[Home] | [Total List]

[182076_s_at]

Description R02C2.3 /REP_DB=WormBase Gene ID /WP=CE12480 /TR=O44545 /GB=AAC48228.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 78      4grp_total > 02      6grp_cgc > 49      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/182076_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 11460
1 2 3 4 range
A 16.2
(-3)
A
8.1
(-3)
A
42.3
(-3)
A
11467.8
(3)
P
11460
B 45
(-3)
A
44.3
(-3)
A
22.2
(-3)
A
9668.2
(3)
P
9646
C 51
(-3)
P
8.6
(-3)
A
26.8
(-3)
A
11343
(3)
P
11334
avr 37.4
(-3)
20.3
(-3)
30.4
(-3)
10826.3
(3)
10806

Warning: fopen(./gnuplot/182076_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3400
1 2 3 4 5 6 range
A 39.8
(-3)
A
16.8
(-3)
A
38.3
(-3)
A
107.3
(-2.8)
P
1020.8
(-1.2)
P
3402.4
(3)
P
3386
B 43.9
(-2.9)
P
21.5
(-3)
A
7.8
(-3)
A
96.7
(-2.8)
P
954
(-1.3)
P
3321.4
(3)
P
3314
C 2.2
(-3)
A
38
(-2.9)
A
11
(-3)
A
75
(-2.8)
P
943
(-1)
P
2818.2
(3)
P
2816
avr 28.6
(-3)
25.4
(-3)
19
(-3)
93
(-2.9)
972.6
(-1.2)
3180.7
(3)
3162
No Scale

Warning: fopen(./gnuplot/182076_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 2059
1 2 3 4 range
A 5.9
(-3)
A
1.8
(-3)
A
11.1
(-3)
A
1678.7
(3)
P
1677
B 14.3
(-3)
A
11
(-3)
A
5.2
(-3)
A
2060.3
(3)
P
2055
C 16.9
(-3)
P
2.5
(-3)
A
9.3
(-3)
A
1912.6
(3)
P
1910
avr 12.4
(-3)
5.1
(-3)
8.5
(-3)
1883.9
(3)
1879

Warning: fopen(./gnuplot/182076_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/182076_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1238
1 2 3 4 5 6 range
A 7.3
(-3)
A
6
(-3)
A
8.3
(-3)
A
27.2
(-2.8)
P
308
(-0.8)
P
828.4
(3)
P
822
B 15.3
(-2.9)
P
7.1
(-3)
A
1.9
(-3)
A
25.6
(-2.9)
P
387.6
(-1.1)
P
1238.5
(3)
P
1237
C 0.8
(-3)
A
11.6
(-2.9)
A
2.8
(-3)
A
15.1
(-2.9)
P
305.1
(-1.1)
P
943.4
(3)
P
943
avr 7.8
(-3)
8.2
(-3)
4.3
(-3)
22.6
(-2.9)
333.6
(-1)
1003.4
(3)
999
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 182076_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15240
Sequence Type Exemplar sequence
Representative Public ID R02C2.3 NCBI
Target Description R02C2.3 /REP_DB=WormBase Gene ID /WP=CE12480 /TR=O44545 /GB=AAC48228.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070762(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070762 NCBI Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-40) (tag-40) mRNA, complete cds. 11/11 None
SNAP00000019095 ENSEMBL cdna:SNAP chromosome:CEL140:V:246480:250326:-1 11/11 None
GENEFINDER00000019103 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:246480:257814:-1 11/11 None
R02C2.3 ENSEMBL cdna:known chromosome:CEL140:V:246447:251575:-1 gene:R02C2.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:246479-251534(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol tag-40
Ensembl R02C2.3
Entrez Gene 178553 Entrez gene
SwissProt O44545 EMBL-EBI
WormBase CE35355 Wormbase
Functional Annotations
Ortholog
ID Title Organism
DROSOPHILA_2:1637590_AT dm
DROSGENOME1:145570_AT dm
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
16747 transferase activity, transferring groups other than amino-acyl groups inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAC48228 Temporarily assigned gene name protein 40 [Caenorhabditis elegans] ref|NP_503163.2| Temporarily Assigned Gene name family member (tag-40) [Caenorhabditis elegans] 0.0
blast CAE58006 Hypothetical protein CBG01075 [Caenorhabditis briggsae] 0.0
blast AAF59486 Hypothetical protein Y39H10A.2 [Caenorhabditis elegans] ref|NP_504041.1| Y39H10A.2 [Caenorhabditis elegans] 0.0
blast AAC48231 Hypothetical protein R02C2.4 [Caenorhabditis elegans] ref|NP_503165.2| R02C2.4 [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR003002 EMBL-EBI 7TM chemoreceptor, subfamily 1 1.1E-55
Pfam IPR003002 EMBL-EBI 7TM chemoreceptor, subfamily 1 3.7E-14
Pfam IPR000536 EMBL-EBI Ligand-binding domain of nuclear hormone receptor 3.0E-49
Pfam IPR001628 EMBL-EBI Zn-finger, C4-type steroid receptor 3.6E-12
Pfam IPR001628 EMBL-EBI Zn-finger, C4-type steroid receptor 7.9E-7
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_503163.2 8 236-258,285-304,360-382,420-442,457-474,495-512,527-549,561-583
R02C2.3 8 236-258,285-304,360-382,420-442,457-474,495-512,527-549,561-583
SNAP00000019095 10 62-84,144-166,181-203,230-249,305-327,365-387,402-419,440-457,472-494,506-528
GENEFINDER00000019103 18 460-482,494-516,541-563,584-606,630-652,659-681,691-713,720-737,872-894,950-972,987-1009,1036-1055,1111-1133,1171-1193,1208-1225,1246-1263,1278-1300,1312-1334
Sequence
Target Sequence
>C. ELEGANS:182076_S_AT
tcatccggggatggttggacgccagttcaaactgcgctttacaggagttactcaaaaact
gcattggccaaacttatattagagtcagtttcggagcaagttttcaaaataattattcaa
aataaaaaaaacattttcataaattacaaatacttctccnnnnnnnnnnnnnnnnnnnnn
nctgctcgaaaaacgtcgaaaaatatatacaattgcttcagtcgagtactctggggattc
gccatgtcatggatcgtaatttccacctactaccgaaaaggattgatcagagactttatg
agtctttcattttggaccccgctggctagactatcattttgcgcttatttggtgcactgg
atggttctcggctatttttttggaagaaatcactcggaattgtatttttcgacgctttcc
tattttttccttgacacagtgatcccagtgactgctctgtcctttgtgatagccatattt
tggtcttcgatg


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCATCCGGGGATGGTTGGACGCCAG 391 619 1681 Antisense
GGACGCCAGTTCAAACTGCGCTTTA 241 523 1697 Antisense
AGTACTCTGGGGATTCGCCATGTCA 473 61 1905 Antisense
TGGATCGTAATTTCCACCTACTACC 138 551 1930 Antisense
GGCTAGACTATCATTTTGCGCTTAT 66 539 2004 Antisense
GCGCTTATTTGGTGCACTGGATGGT 216 287 2021 Antisense
GATGGTTCTCGGCTATTTTTTTGGA 622 407 2040 Antisense
TGTATTTTTCGACGCTTTCCTATTT 355 561 2081 Antisense
ACAGTGATCCCAGTGACTGCTCTGT 382 105 2116 Antisense
ACTGCTCTGTCCTTTGTGATAGCCA 656 97 2131 Antisense
GATAGCCATATTTTGGTCTTCGATG 419 425 2148 Antisense
Sequence Source Affymetrix Proprietary Database