[Home] | [Total List]

[181464_at]

Description Y43F8B.5 /REP_DB=WormBase Gene ID /WP=CE21890 /TR=Q9XWX3 /GB=CAA21513.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 98      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/181464_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 814
1 2 3 4 range
A 11.4
(-3)
A
7.9
(-3)
A
8.1
(-3)
A
799.3
(3)
P
791
B 35.6
(-2.8)
A
8.2
(-3)
A
9.4
(-3)
A
703
(3)
P
695
C 8.6
(-3)
A
9.1
(-3)
A
6.6
(-3)
A
820.5
(3)
P
814
avr 18.5
(-2.9)
8.4
(-3)
8
(-3)
774.3
(3)
766

Warning: fopen(./gnuplot/181464_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 158
1 2 3 4 5 6 range
A 11.2
(-2.8)
A
6.3
(-3)
A
5.3
(-3)
A
53.1
(-1.2)
A
109.4
(1)
P
163.2
(3)
P
158
B 6.6
(-3)
A
9.1
(-2.9)
A
6.8
(-3)
A
22.4
(-2.4)
A
159.3
(3)
P
145.2
(2.4)
P
153
C 5.9
(-3)
A
8
(-2.9)
A
5.2
(-3)
A
34.9
(-1.8)
A
114.3
(1.3)
M
156.7
(3)
P
152
avr 7.9
(-2.9)
7.8
(-2.9)
5.8
(-3)
36.8
(-1.8)
127.7
(1.9)
155
(3)
149
No Scale

Warning: fopen(./gnuplot/181464_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 148
1 2 3 4 range
A 4.2
(-2.9)
A
1.7
(-3)
A
2.1
(-3)
A
117
(3)
P
115
B 11.3
(-2.6)
A
2
(-3)
A
2.2
(-3)
A
149.8
(3)
P
148
C 2.8
(-3)
A
2.6
(-3)
A
2.3
(-3)
A
138.3
(3)
P
136
avr 6.1
(-2.8)
2.1
(-3)
2.2
(-3)
135
(3)
133

Warning: fopen(./gnuplot/181464_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/181464_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 64
1 2 3 4 5 6 range
A 2.1
(-2.9)
A
2.2
(-2.8)
A
1.2
(-3)
A
13.5
(-1.1)
A
33
(2)
P
39.7
(3)
P
39
B 2.3
(-2.9)
A
3
(-2.9)
A
1.7
(-3)
A
5.9
(-2.6)
A
64.7
(3)
P
54.2
(2)
P
63
C 2.2
(-2.9)
A
2.4
(-2.9)
A
1.3
(-3)
A
7
(-2.3)
A
37
(1.2)
M
52.5
(3)
P
51
avr 2.2
(-2.9)
2.5
(-2.9)
1.4
(-3)
8.8
(-2.1)
44.9
(2.5)
48.8
(3)
47
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 181464_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13408
Sequence Type Exemplar sequence
Representative Public ID Y43F8B.5 NCBI
Target Description Y43F8B.5 /REP_DB=WormBase Gene ID /WP=CE21890 /TR=Q9XWX3 /GB=CAA21513.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_075392(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_075392 NCBI Caenorhabditis elegans Y43F8B.5 (Y43F8B.5) mRNA, complete cds. 11/11 None
SNAP00000027179 ENSEMBL cdna:SNAP chromosome:CEL140:V:19496764:19498259:-1 11/11 None
GENEFINDER00000027188 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:19497334:19498259:-1 11/11 None
Y43F8B.5 ENSEMBL cdna:known chromosome:CEL140:V:19497334:19498259:-1 gene:Y43F8B.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:19497333-19498259(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y43F8B.5
Entrez Gene 189870 Entrez gene
SwissProt Q9XWX3 EMBL-EBI
WormBase CE21890 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5576 extracellular region inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA21513 Hypothetical protein Y43F8B.5 [Caenorhabditis elegans] ref|NP_507793.1| Y43F8B.5 [Caenorhabditis elegans] 1.0E-104
blast CAA21513 Hypothetical protein Y43F8B.5 [Caenorhabditis elegans] ref|NP_507793.1| Y43F8B.5 [Caenorhabditis elegans] 1.0E-102
blast CAE66256 Hypothetical protein CBG11500 [Caenorhabditis briggsae] 3.0E-21
blast CAE60016 Hypothetical protein CBG03518 [Caenorhabditis briggsae] 3.0E-21
Protein Domains
Database ID Description E-Value
Pfam IPR001283 EMBL-EBI Allergen V5/Tpx-1 related 4.3E-27
Sequence
Target Sequence
>C. ELEGANS:181464_AT
ccatgcccaatttagtgcgtctgctcaaaaggaaatagtcacctacattaacgatttacg
ctccctcgtggcaagtagaagatttcatctcgattctcgagatgttgaaactttgccgcc
agcgtcagatatgcttaaaatgacctggaactctacgctggcagttgcagcgcaaaaact
tgcaaaaacttgctttattgctgttgaatcgtcgtcgcctggaatagccgacaaacgtat
tgtagcagcaaacgtggttacggttgccaaaaatgcactgggtcattggaaacactcact
aaacaaagaatggaacttgaaaagttataatagtaattacattggaattcaactaatctg
ggccaaatcttcatcagttggctgtgggtttagtccgtgtgaaatagactcccaggggag
acgttggtacaaagtagtgtgttcgtttgagaaaaaaggaggtattactcgtgagcccgt
ctacaaaaagggaaaagcctgcgaggcgtgtccag


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CCATGCCCAATTTAGTGCGTCTGCT 679 271 54 Antisense
TACATTAACGATTTACGCTCCCTCG 228 645 97 Antisense
CGCTCCCTCGTGGCAAGTAGAAGAT 342 255 112 Antisense
GAGATGTTGAAACTTTGCCGCCAGC 220 397 152 Antisense
TGCCGCCAGCGTCAGATATGCTTAA 390 585 167 Antisense
GGAACTCTACGCTGGCAGTTGCAGC 28 531 200 Antisense
TTATTGCTGTTGAATCGTCGTCGCC 157 679 248 Antisense
GCACTGGGTCATTGGAAACACTCAC 693 313 328 Antisense
AGTTGGCTGTGGGTTTAGTCCGTGT 395 63 429 Antisense
TATTACTCGTGAGCCCGTCTACAAA 594 661 516 Antisense
GGAAAAGCCTGCGAGGCGTGTCCAG 707 525 544 Antisense
Sequence Source Affymetrix Proprietary Database