[Home] | [Total List]

[180519_at]

Description W05H9.2 /REP_DB=WormBase Gene ID /WP=CE05037 /TR=Q23178 /GB=AAA81725.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Cluster 6grp_total > 0      4grp_total > 15      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/180519_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 172
1 2 3 4 range
A 73.3
(0.1)
A
12
(-3)
A
18.7
(-2.7)
A
129.7
(3)
A
118
B 180.4
(3)
A
8.1
(-3)
A
48.9
(-1.6)
A
145.4
(1.8)
A
172
C 55.1
(0.7)
A
9.1
(-3)
A
84
(3)
A
79.1
(2.6)
A
75
avr 102.9
(2.2)
9.7
(-3)
50.5
(-0.7)
118.1
(3)
108

Warning: fopen(./gnuplot/180519_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 118
1 2 3 4 5 6 range
A 33.9
(-3)
A
148.6
(2.9)
P
37
(-2.8)
A
71
(-1.1)
P
150.8
(3)
A
107.5
(0.8)
A
117
B 114.9
(2.2)
A
105.4
(0.9)
P
120.6
(3)
P
85.8
(-1.8)
A
88.2
(-1.5)
A
77.5
(-3)
A
43
C 93.2
(-1.2)
A
122.2
(0.9)
P
68.8
(-3)
A
151.6
(3)
P
75
(-2.6)
P
97.1
(-0.9)
A
83
avr 80.7
(-2.4)
125.4
(3)
75.5
(-3)
102.8
(0.3)
104.7
(0.5)
94
(-0.8)
50
No Scale

Warning: fopen(./gnuplot/180519_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 56
1 2 3 4 range
A 26.7
(3)
A
2.6
(-3)
A
4.9
(-2.4)
A
19
(1.1)
A
24
B 57.5
(3)
A
2
(-3)
A
11.3
(-2)
A
31
(0.1)
A
56
C 18.2
(0.5)
A
2.6
(-3)
A
29.3
(3)
A
13.3
(-0.6)
A
27
avr 34.1
(3)
2.4
(-3)
15.2
(-0.6)
21.1
(0.5)
32

Warning: fopen(./gnuplot/180519_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180519_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 47
1 2 3 4 5 6 range
A 6.2
(-3)
A
52.9
(3)
P
8.1
(-2.8)
A
18
(-1.5)
P
45.5
(2)
A
26.2
(-0.4)
A
47
B 40
(3)
A
35.1
(1.3)
P
29.3
(-0.7)
P
22.7
(-3)
A
35.9
(1.6)
A
28.9
(-0.8)
A
17
C 34.5
(2.2)
A
37.3
(3)
P
17.5
(-3)
A
30.5
(0.9)
P
24.3
(-0.9)
P
32.5
(1.5)
A
20
avr 26.9
(-0.8)
41.8
(3)
18.3
(-3)
23.7
(-1.6)
35.2
(1.3)
29.2
(-0.2)
23
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 180519_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.16130
Sequence Type Exemplar sequence
Representative Public ID W05H9.2 NCBI
Target Description W05H9.2 /REP_DB=WormBase Gene ID /WP=CE05037 /TR=Q23178 /GB=AAA81725.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076648(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076648 NCBI Caenorhabditis elegans W05H9.2 (W05H9.2) mRNA, complete cds. 11/11 None
GENEFINDER00000008329 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:6267006:6270621:1 11/11 None
SNAP00000008326 ENSEMBL cdna:SNAP chromosome:CEL140:X:6269725:6270621:1 11/11 None
W05H9.2 ENSEMBL cdna:known chromosome:CEL140:X:6267006:6271008:1 gene:W05H9.2 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:6263609-6270621(+) 98.88 100.0
Public Domain and Genome References
Gene Title
Ensembl W05H9.2
Entrez Gene 180899 Entrez gene
SwissProt Q23178 EMBL-EBI
WormBase CE33720 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAO91681 Hypothetical protein W05H9.2 [Caenorhabditis elegans] ref|NP_509049.3| W05H9.2 [Caenorhabditis elegans] 0.0
blast T26204 hypothetical protein W05H9.2 - Caenorhabditis elegans 0.0
blast AAO91681 Hypothetical protein W05H9.2 [Caenorhabditis elegans] ref|NP_509049.3| W05H9.2 [Caenorhabditis elegans] 1.0E-140
blast T26204 hypothetical protein W05H9.2 - Caenorhabditis elegans 1.0E-140
blast AAO91682 Hypothetical protein W05H9.4 [Caenorhabditis elegans] ref|NP_001024943.1| W05H9.4 [Caenorhabditis elegans] 5.0E-73
Sequence
Target Sequence
>C. ELEGANS:180519_AT
caaacaacttgcggctcagttctcgcagattctcattcaagaaattgatctcacaaattc
tagaatcagatatcaaactaaaatgcaaacagcttaccttgctcacagaattgccagaat
gatggctgggacttacatggattatgtgtgtaacaacatgaagaacccgccgtctagatg
ccgtgtaagaactccaacaccaattccagaagacgatcttccagaagacacagctgaagg
ctccgaagagggtagagaatctgaagagactggctcggaaaccggatcggattacgcaac
agatgaaggaccaaatgtcggacgtcgtcgggttagacgaaatgtagaattggaaagcga
tgatgatgatgaagatgaagaggaagatgaagaagaggaggacggcgttgagcgtcaatt
tgatcccgaggaggccgccagagttgcattccttctcaatacgttttctatgaatggaaa
tgtcatcttcgtggagaatgaaggtgacgtagaagacgatcgcgttccagatgacgtgat
tgataacttcattcgcaatgttcgcagagtgcacatggagccgga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CAAACAACTTGCGGCTCAGTTCTCG 498 191 4134 Antisense
CAGTTCTCGCAGATTCTCATTCAAG 322 207 4150 Antisense
GCTTACCTTGCTCACAGAATTGCCA 628 303 4225 Antisense
GTAACAACATGAAGAACCCGCCGTC 264 461 4283 Antisense
GAGACTGGCTCGGAAACCGGATCGG 701 385 4399 Antisense
GACCAAATGTCGGACGTCGTCGGGT 350 379 4442 Antisense
AGCGTCAATTTGATCCCGAGGAGGC 137 83 4544 Antisense
CGAGGAGGCCGCCAGAGTTGCATTC 586 249 4560 Antisense
CATTCCTTCTCAATACGTTTTCTAT 540 217 4580 Antisense
GACGATCGCGTTCCAGATGACGTGA 219 379 4648 Antisense
TTCGCAGAGTGCACATGGAGCCGGA 397 697 4694 Antisense
Sequence Source Affymetrix Proprietary Database