[Home] | [Total List]

[180297_at]

Description C06A8.6 /REP_DB=WormBase Gene ID /WP=CE02457 /TR=Q17692 /GB=AAA81047.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 88      4grp_total > 07      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/180297_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 92
1 2 3 4 range
A 70.9
(3)
P
3
(-3)
A
40.7
(0.3)
A
36.7
(-0)
A
68
B 48.7
(2.7)
A
4.2
(-3)
A
51.2
(3)
A
46.4
(2.4)
A
47
C 55.3
(0.1)
P
14.2
(-3)
A
33.3
(-1.6)
A
94.9
(3)
P
81
avr 58.3
(2.9)
7.1
(-3)
41.7
(1)
59.3
(3)
52

Warning: fopen(./gnuplot/180297_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 431
1 2 3 4 5 6 range
A 40.8
(-3)
A
62.8
(-2.6)
A
53.2
(-2.8)
A
75.6
(-2.4)
P
282.9
(1.3)
P
378.5
(3)
P
338
B 16.5
(-3)
A
57.8
(-2.3)
P
33.6
(-2.7)
A
61.7
(-2.2)
M
199.3
(0.1)
P
373.4
(3)
P
357
C 21.5
(-3)
A
30.7
(-2.9)
A
28.2
(-2.9)
A
39.7
(-2.7)
A
265.6
(0.4)
P
447.8
(3)
P
426
avr 26.3
(-3)
50.4
(-2.6)
38.3
(-2.8)
59
(-2.5)
249.3
(0.6)
399.9
(3)
374
No Scale

Warning: fopen(./gnuplot/180297_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 25
1 2 3 4 range
A 25.8
(3)
P
0.6
(-3)
A
10.6
(-0.6)
A
5.4
(-1.9)
A
25
B 15.5
(3)
A
1
(-3)
A
11.9
(1.5)
A
9.9
(0.7)
A
15
C 18.3
(3)
P
4.1
(-3)
A
11.6
(0.2)
A
16
(2)
P
14
avr 19.9
(3)
1.9
(-3)
11.4
(0.2)
10.4
(-0.2)
18

Warning: fopen(./gnuplot/180297_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180297_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 144
1 2 3 4 5 6 range
A 7.5
(-3)
A
22.3
(-2)
A
11.6
(-2.7)
A
19.2
(-2.2)
P
85.4
(2.5)
P
92.1
(3)
P
85
B 5.7
(-3)
A
19.2
(-2.4)
P
8.2
(-2.9)
A
16.3
(-2.5)
M
81
(0.4)
P
139.2
(3)
P
134
C 8
(-3)
A
9.4
(-2.9)
A
7.2
(-3)
A
8
(-3)
A
86
(0.3)
P
149.9
(3)
P
143
avr 7.1
(-3)
17
(-2.5)
9
(-2.9)
14.5
(-2.6)
84.1
(0.9)
127.1
(3)
120
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 180297_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4683
Sequence Type Exemplar sequence
Representative Public ID C06A8.6 NCBI
Target Description C06A8.6 /REP_DB=WormBase Gene ID /WP=CE02457 /TR=Q17692 /GB=AAA81047.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_063233(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_063233 NCBI Caenorhabditis elegans C06A8.6 (C06A8.6) mRNA, complete cds. 11/11 None
SNAP00000042209 ENSEMBL cdna:SNAP chromosome:CEL140:II:7772536:7773786:1 11/11 None
GENEFINDER00000042223 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:7772536:7773786:1 11/11 None
C06A8.6 ENSEMBL cdna:known chromosome:CEL140:II:7772488:7773825:1 gene:C06A8.6 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:7772532-7773783(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl C06A8.6
Entrez Gene 174253 Entrez gene
SwissProt Q17692 EMBL-EBI
WormBase CE02457 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:245938_AT leucine-rich repeat family protein at
DROSOPHILA_2:1631226_AT dm
DROSGENOME1:153217_AT dm
CHICKEN:GGA.5583.1.S1_A_AT protein phosphatase 1, regulatory subunit 7 gga
HUGENEFL:Z50749_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133A:201214_S_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133_PLUS_2:201214_S_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133A_2:201214_S_AT protein phosphatase 1, regulatory subunit 7 hs
U133_X3P:G4506012_3P_A_AT protein phosphatase 1, regulatory subunit 7 hs
U133_X3P:HS.36587.1.S1_3P_A_AT protein phosphatase 1, regulatory subunit 7 hs
U133_X3P:HS.36587.0.S2_3P_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133A_2:201213_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133_PLUS_2:201213_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133A:201213_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133A_2:213465_S_AT protein phosphatase 1, regulatory subunit 7 hs
HG-FOCUS:213465_S_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133_PLUS_2:213465_S_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U133A:213465_S_AT protein phosphatase 1, regulatory subunit 7 hs
HG-U95AV2:41540_AT protein phosphatase 1, regulatory subunit 7 hs
U133_X3P:HS2.119214.1.S1_3P_S_AT Protein phosphatase 1, regulatory subunit 7 hs
U133_X3P:HS2.119214.1.S1_3P_AT Protein phosphatase 1, regulatory subunit 7 hs
U133_X3P:1559053_3P_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U133_PLUS_2:1559053_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U133_PLUS_2:1559054_A_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U95C:66333_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U133_PLUS_2:244525_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U133B:244525_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U95B:43940_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U95D:68967_AT Protein phosphatase 1, regulatory subunit 7 hs
HG-U95D:76726_AT Protein phosphatase 1, regulatory subunit 7 hs
HU35KSUBA:H90110_AT Protein phosphatase 1, regulatory subunit 7 hs
HU35KSUBB:RC_R46512_AT Protein phosphatase 1, regulatory subunit 7 hs
U133_X3P:HS.124995.0.A1_3P_AT Protein phosphatase 1, regulatory subunit 7 hs
MU11KSUBA:AA271109_S_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MG-U74AV2:97979_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MG-U74CV2:170922_I_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MOE430A:1448888_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MOUSE430A_2:1448888_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MOUSE430_2:1448888_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MOE430A:1417919_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MOUSE430A_2:1417919_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MOUSE430_2:1417919_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 mm
MG-U74CV2:135092_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7, mRNA (cDNA clone MGC:19201 IMAGE:4237290) mm
MU19KSUBB:TC28819_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7, mRNA (cDNA clone MGC:19201 IMAGE:4237290) mm
MU19KSUBB:TC30481_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7, mRNA (cDNA clone MGC:19201 IMAGE:4237290) mm
MU19KSUBB:TC30481_G_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7, mRNA (cDNA clone MGC:19201 IMAGE:4237290) mm
RG-U34B:RC_AI044552_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RG-U34B:RC_AI059244_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAE230A:1373073_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAT230_2:1373073_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAE230B:1383277_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAT230_2:1383277_AT protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAE230A:1376566_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAT230_2:1376566_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAE230B:1383452_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RAT230_2:1383452_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
RG-U34B:RC_AI043966_AT Protein phosphatase 1, regulatory (inhibitor) subunit 7 (predicted) rn
YEAST_2:1772697_AT Conserved nuclear regulatory subunit of Glc7p type 1 protein serine-threonine phosphatase (PP1), functions positively with Glc7p to promote dephosphorylation of nuclear substrates required for chromosome transmission during mitosis Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
9401 phosphoenolpyruvate-dependent sugar phosphotransferase system inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5351 sugar porter activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA81047 Hypothetical protein C06A8.6 [Caenorhabditis elegans] ref|NP_495634.1| C06A8.6 [Caenorhabditis elegans] 1.0E-179
blast CAE67461 Hypothetical protein CBG12962 [Caenorhabditis briggsae] 1.0E-145
blast EAA14303 ENSANGP00000015763 [Anopheles gambiae str. PEST] ref|XP_318952.2| ENSANGP00000015763 [Anopheles gambiae str. PEST] 6.0E-59
Protein Domains
Database ID Description E-Value
Pfam IPR001611 EMBL-EBI Leucine-rich repeat 0.21
Pfam IPR001611 EMBL-EBI Leucine-rich repeat 6.8E-5
Pfam IPR001611 EMBL-EBI Leucine-rich repeat 0.42
Pfam IPR001611 EMBL-EBI Leucine-rich repeat 0.64
Sequence
Target Sequence
>C. ELEGANS:180297_AT
actcgatagattgttccttggcgctaatcagattcgtcttattgaaaatgttgatcattt
gaagaagctcacagttctcagtcttccagccaatgcgattactgtagttgataacatttc
gggacttcacaacttgaaagagatttatctggctcaaaatggcatcaagtacgtttgtgg
aatcgatgagcatcttcctcttgaaattctggatttcaatcagaatcgtcttgagaaggt
cgagaatatccatcaattgaagacacttacagacttttgggcaagaggaaataagttgga
taactggagcattatggatgaattggttgaacttccacaactcaatagtgtttacctcga
tttcaatccaattgcatcagtggatacttatcgtggaaaggttattcatctcttgcaaca
aattactcgtcttgatggaactcagtgccgtgagcattcgatgctccgtccaccaaaaga
agagaagaatgagacagagctttcgcgtgttgtac


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACTCGATAGATTGTTCCTTGGCGCT 3 101 507 Antisense
TTCCTTGGCGCTAATCAGATTCGTC 319 701 520 Antisense
AGAAGCTCACAGTTCTCAGTCTTCC 208 75 569 Antisense
TCAGTCTTCCAGCCAATGCGATTAC 650 623 584 Antisense
AACATTTCGGGACTTCACAACTTGA 162 137 619 Antisense
ATCGATGAGCATCTTCCTCTTGAAA 265 37 688 Antisense
GAAGACACTTACAGACTTTTGGGCA 317 339 765 Antisense
ATAGTGTTTACCTCGATTTCAATCC 257 3 851 Antisense
GTCTTGATGGAACTCAGTGCCGTGA 237 469 935 Antisense
GCCGTGAGCATTCGATGCTCCGTCC 686 281 953 Antisense
GAGACAGAGCTTTCGCGTGTTGTAC 257 393 997 Antisense
Sequence Source Affymetrix Proprietary Database