[Home] | [Total List]

[180145_s_at]

Description Y51H4A.7 /REP_DB=WormBase Gene ID /WP=CE22333 /TR=Q9NAE2 /GB=CAB61139.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 24      6grp_high1_10_10 > 32      4grp_highest_8_8 > 39      4grp_high_8_8 > 04      6grp_highest_nonorm > 43      6grp_total > 31      4grp_total > 04      6grp_high1_sub > 02_03      6grp_total_sub > Hat      6grp_rule_based > S3      

Scale

Warning: fopen(./gnuplot/180145_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1401
1 2 3 4 range
A 927.5
(-1.4)
P
560.4
(-3)
P
629
(-2.7)
P
1924.9
(3)
P
1365
B 1015.6
(-1.1)
P
689.4
(-2.9)
P
674
(-3)
P
1725.8
(3)
P
1052
C 893.8
(-1)
P
580.9
(-2.7)
P
524.3
(-3)
P
1625.1
(3)
P
1101
avr 945.6
(-1.2)
610.2
(-3)
609.1
(-3)
1758.6
(3)
1150

Warning: fopen(./gnuplot/180145_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1228
1 2 3 4 5 6 range
A 918.2
(0.5)
P
1162.3
(1.9)
P
1336.7
(3)
P
979.9
(0.8)
P
808.9
(-0.2)
P
344
(-3)
P
993
B 964.6
(0.2)
P
1344.3
(2.2)
P
1506.3
(3)
P
1180.3
(1.3)
P
783.4
(-0.7)
P
341.3
(-3)
P
1165
C 719.1
(-0.7)
P
1213.4
(1.9)
P
1423.1
(3)
P
757.6
(-0.5)
P
680.6
(-0.9)
P
278.6
(-3)
P
1145
avr 867.3
(-0)
1240
(2)
1422
(3)
972.6
(0.6)
757.6
(-0.6)
321.3
(-3)
1101
No Scale

Warning: fopen(./gnuplot/180145_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 246
1 2 3 4 range
A 337.7
(3)
P
121.6
(-3)
P
164.4
(-1.8)
P
281.8
(1.4)
P
216
B 323.9
(1.8)
P
170.3
(-2.6)
P
156.2
(-3)
P
367.8
(3)
P
212
C 295.9
(3)
P
167
(-3)
P
182.7
(-2.3)
P
274
(2)
P
129
avr 319.2
(3)
153
(-3)
167.8
(-2.5)
307.9
(2.6)
166

Warning: fopen(./gnuplot/180145_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/180145_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 364
1 2 3 4 5 6 range
A 169.3
(-1.4)
P
413.4
(3)
P
291.1
(0.8)
P
248.5
(-0)
P
244.1
(-0.1)
P
83.8
(-3)
P
330
B 335.6
(0.9)
P
447.5
(3)
P
365.8
(1.5)
P
312.6
(0.5)
P
318.3
(0.6)
P
127.3
(-3)
P
320
C 266.6
(0.8)
P
370.3
(3)
P
362.2
(2.8)
P
152.4
(-1.7)
P
220.2
(-0.3)
P
93.3
(-3)
P
277
avr 257.2
(0)
410.4
(3)
339.7
(1.6)
237.8
(-0.4)
260.9
(0.1)
101.5
(-3)
309
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 180145_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8724
Sequence Type Exemplar sequence
Representative Public ID Y51H4A.7 NCBI
Target Description Y51H4A.7 /REP_DB=WormBase Gene ID /WP=CE22333 /TR=Q9NAE2 /GB=CAB61139.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070563(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070563 NCBI Caenorhabditis elegans Y51H4A.7 (Y51H4A.7) mRNA, complete cds. 11/11 None
SNAP00000000180 ENSEMBL cdna:SNAP chromosome:CEL140:IV:16535773:16542874:-1 11/11 None
GENEFINDER00000000217 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:16535773:16542874:-1 11/11 None
Y51H4A.7.1 ENSEMBL cdna:known chromosome:CEL140:IV:16535270:16542854:-1 gene:Y51H4A.7 11/11 None
Y51H4A.7.2 ENSEMBL cdna:known chromosome:CEL140:IV:16535695:16542854:-1 gene:Y51H4A.7 11/11 None
Y51H4A.7.3 ENSEMBL cdna:known chromosome:CEL140:IV:16535710:16542292:-1 gene:Y51H4A.7 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:16535778-16542880(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y51H4A.7
Entrez Gene 178460 Entrez gene
WormBase CE35671 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE:1591961_AT similar to urocanase domain containing 1 cfa
CANINE_2:CFA.14451.1.A1_AT similar to urocanase domain containing 1 cfa
CANINE_2:CFAAFFX.6730.1.S1_S_AT similar to urocanase domain containing 1 cfa
CHICKEN:GGAAFFX.3933.3.S1_S_AT similar to CDNA sequence BC022133 gga
HU35KSUBB:RC_R01081_AT urocanase domain containing 1 hs
HG-U95C:56486_AT urocanase domain containing 1 hs
U133_X3P:HS2.331148.1.S1_3P_S_AT urocanase domain containing 1 hs
U133_X3P:HS2.331148.1.S1_3P_AT urocanase domain containing 1 hs
U133_X3P:1553341_3P_AT urocanase domain containing 1 hs
HG-U133_PLUS_2:1553341_AT urocanase domain containing 1 hs
HG-U95B:42777_AT urocanase domain containing 1 hs
MOE430A:1425003_AT urocanase domain containing 1 mm
MOUSE430A_2:1425003_AT urocanase domain containing 1 mm
MOUSE430_2:1425003_AT urocanase domain containing 1 mm
MG-U74BV2:115221_AT urocanase domain containing 1 mm
MOE430A:1451565_S_AT urocanase domain containing 1 mm
MOUSE430A_2:1451565_S_AT urocanase domain containing 1 mm
MOUSE430_2:1451565_S_AT urocanase domain containing 1 mm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6548 histidine catabolism inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
16153 urocanate hydratase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB61139 Hypothetical protein Y51H4A.7 [Caenorhabditis elegans] ref|NP_502964.2| Y51H4A.7 [Caenorhabditis elegans] 0.0
blast Q9NAE2 Probable urocanate hydratase (Urocanase) (Imidazolonepropionate hydrolase) 0.0
blast CAE68065 Hypothetical protein CBG13687 [Caenorhabditis briggsae] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR000193 EMBL-EBI Urocanase 1.6E-102
Pfam IPR000193 EMBL-EBI Urocanase 1.6E-102
Sequence
Target Sequence
>C. ELEGANS:180145_S_AT
gatactgatgtccccgaatacgtgaaacagcaatatttggacaacaagaaatggatagaa
gaagccgagaaaaataagctcgtcgttggctcacaggcacggattctatattcggatcgt
gctggaagagttgcattggcttctgcattcaatgagctcgtgaaatctggaaaagtgtcg
gctgcaattgtaatttcaagagatcatcatgatgtttctggaactgattctccattccgt
gagacttcaaatgtttatgatggaagtgcttttacagctgatatggctgtacagaattgt
attggtgactcattccgtggtgctacatgggttgcccttcacaatggtggaggtgttgga
tggggtgacgtcatcaatggaggtttcggtattgttcttgatggctcaagtgatgctgcc
cgccgagctgaaggaatgctcaattgggatgtacctaatggagttactcgtcgttcttgg
tctggaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GATACTGATGTCCCCGAATACGTGA 36 425 1612 Antisense
AAATAAGCTCGTCGTTGGCTCACAG 71 115 1683 Antisense
GGCTCACAGGCACGGATTCTATATT 327 539 1699 Antisense
GAGTTGCATTGGCTTCTGCATTCAA 27 399 1739 Antisense
GATTCTCCATTCCGTGAGACTTCAA 146 433 1837 Antisense
ATTCCGTGGTGCTACATGGGTTGCC 348 7 1923 Antisense
GGTTGCCCTTCACAATGGTGGAGGT 292 505 1941 Antisense
GTTTCGGTATTGTTCTTGATGGCTC 396 449 1994 Antisense
TGATGGCTCAAGTGATGCTGCCCGC 525 567 2010 Antisense
CTGCCCGCCGAGCTGAAGGAATGCT 504 237 2027 Antisense
TTACTCGTCGTTCTTGGTCTGGAAA 10 683 2075 Antisense
Sequence Source Affymetrix Proprietary Database