[Home] | [Total List]

[179256_at]

Description F14D7.5 /REP_DB=WormBase Gene ID /WP=CE09383 /TR=Q19457 /GB=CAB01161.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 77      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/179256_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 4260
1 2 3 4 range
A 3.1
(-3)
A
3
(-3)
A
2
(-3)
A
4039.9
(3)
P
4038
B 5
(-3)
A
3
(-3)
A
1.2
(-3)
A
3783.5
(3)
P
3782
C 2.1
(-3)
A
2
(-3)
A
1.8
(-3)
A
4260.8
(3)
P
4259
avr 3.4
(-3)
2.7
(-3)
1.7
(-3)
4028.1
(3)
4026

Warning: fopen(./gnuplot/179256_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1361
1 2 3 4 5 6 range
A 1.9
(-3)
A
1.5
(-3)
A
1.7
(-3)
A
2.6
(-3)
A
154.1
(-2.1)
P
1016.3
(3)
P
1015
B 1.2
(-3)
A
2.4
(-3)
A
9.3
(-3)
A
2
(-3)
A
227.3
(-2)
P
1362.2
(3)
P
1361
C 1.7
(-3)
A
1.2
(-3)
A
2.1
(-3)
A
1.9
(-3)
A
221
(-1.7)
P
1053.4
(3)
P
1052
avr 1.6
(-3)
1.7
(-3)
4.4
(-3)
2.2
(-3)
200.8
(-2)
1144
(3)
1142
No Scale

Warning: fopen(./gnuplot/179256_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 806
1 2 3 4 range
A 1.1
(-3)
A
0.7
(-3)
A
0.5
(-3)
A
591.4
(3)
P
591
B 1.6
(-3)
A
0.7
(-3)
A
0.3
(-3)
A
806.3
(3)
P
806
C 0.7
(-3)
A
0.6
(-3)
A
0.6
(-3)
A
718.4
(3)
P
718
avr 1.1
(-3)
0.7
(-3)
0.5
(-3)
705.4
(3)
705

Warning: fopen(./gnuplot/179256_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179256_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 508
1 2 3 4 5 6 range
A 0.4
(-3)
A
0.5
(-3)
A
0.4
(-3)
A
0.7
(-3)
A
46.5
(-1.9)
P
247.4
(3)
P
247
B 0.4
(-3)
A
0.8
(-3)
A
2.3
(-3)
A
0.5
(-3)
A
92.3
(-1.9)
P
507.9
(3)
P
508
C 0.6
(-3)
A
0.4
(-3)
A
0.5
(-3)
A
0.4
(-3)
A
71.5
(-1.8)
P
352.6
(3)
P
352
avr 0.5
(-3)
0.6
(-3)
1.1
(-3)
0.5
(-3)
70.1
(-1.9)
369.3
(3)
369
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 179256_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12523
Sequence Type Exemplar sequence
Representative Public ID F14D7.5 NCBI
Target Description F14D7.5 /REP_DB=WormBase Gene ID /WP=CE09383 /TR=Q19457 /GB=CAB01161.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074142(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074142 NCBI Caenorhabditis elegans F14D7.5 (F14D7.5) mRNA, complete cds. 11/11 None
SNAP00000017355 ENSEMBL cdna:SNAP chromosome:CEL140:V:14301768:14302230:-1 11/11 None
GENEFINDER00000017365 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:14301768:14302230:-1 11/11 None
F14D7.5 ENSEMBL cdna:known chromosome:CEL140:V:14301768:14302230:-1 gene:F14D7.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:14301767-14302230(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl F14D7.5
Entrez Gene 184465 Entrez gene
SwissProt Q19457 EMBL-EBI
WormBase CE09383 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAB01161 Hypothetical protein F14D7.5 [Caenorhabditis elegans] ref|NP_506543.1| F14D7.5 [Caenorhabditis elegans] 6.0E-42
blast CAB04003 Hypothetical protein C55A1.7 [Caenorhabditis elegans] emb|CAB04002.1| Hypothetical protein C55A1.4 [Caenorhabditis elegans] ref|NP_506892.1| C55A1.7 [Caenorhabditis elegans] ref|NP_506890.1| C55A1.4 [Caenorhabditis elegans] 3.0E-34
blast CAE60949 Hypothetical protein CBG04677 [Caenorhabditis briggsae] 1.0E-33
Sequence
Target Sequence
>C. ELEGANS:179256_AT
tctttccgttttggcggtattcgtggctcaagctacaatgaatcttccatctcaggagca
gtacaatgctgaattgaaatcagcgggcatgtctcaagctggaatcgatggattgaatgt
tttgagccaaaagtttgtgagccaatacccagtcgtccaggctaacaaggaagcagccga
caagtttttggctgaatacacagaagaagcacaaaattatgtcaagtcaatgtctccaga
a


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCTTTCCGTTTTGGCGGTATTCGTG 110 615 33 Antisense
GCGGTATTCGTGGCTCAAGCTACAA 633 291 46 Antisense
CAAGCTACAATGAATCTTCCATCTC 1 187 61 Antisense
GAATCTTCCATCTCAGGAGCAGTAC 658 327 72 Antisense
GAATTGAAATCAGCGGGCATGTCTC 36 323 103 Antisense
TCAGCGGGCATGTCTCAAGCTGGAA 652 623 112 Antisense
GATGGATTGAATGTTTTGAGCCAAA 459 407 139 Antisense
ACCCAGTCGTCCAGGCTAACAAGGA 341 87 179 Antisense
ACAAGGAAGCAGCCGACAAGTTTTT 410 107 197 Antisense
GACAAGTTTTTGGCTGAATACACAG 342 365 211 Antisense
TTATGTCAAGTCAATGTCTCCAGAA 198 679 249 Antisense
Sequence Source Affymetrix Proprietary Database