[Home] | [Total List]

[179185_at]

Description F40D4.2 /REP_DB=WormBase Gene ID /WP=CE19836 /TR=Q9U3G3 /GB=CAB63199.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 60      4grp_total > 06      6grp_cgc > 75      6grp_cgc_sub > 03_04      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/179185_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 73
1 2 3 4 range
A 11.1
(-2.4)
A
4.9
(-2.9)
A
3.8
(-3)
A
75.7
(3)
P
72
B 21.8
(2)
A
3.8
(-3)
A
25.3
(3)
A
19.6
(1.4)
A
22
C 53.1
(3)
A
3.2
(-3)
A
4.8
(-2.8)
A
20.4
(-0.9)
A
50
avr 28.7
(1.3)
4
(-3)
11.3
(-1.7)
38.6
(3)
35

Warning: fopen(./gnuplot/179185_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 44
1 2 3 4 5 6 range
A 7.1
(-2.3)
A
28.2
(1.4)
A
5.3
(-2.7)
A
23.2
(0.5)
A
3.3
(-3)
A
37.6
(3)
A
34
B 10.8
(-1.6)
A
27.5
(3)
A
18.6
(0.5)
A
6.5
(-2.8)
A
16
(-0.2)
A
5.9
(-3)
A
22
C 17.5
(-0.9)
A
2.5
(-3)
A
38.5
(1.9)
A
46.4
(3)
A
21.7
(-0.4)
A
2.2
(-3)
A
44
avr 11.8
(-3)
19.4
(0.4)
20.8
(1)
25.4
(3)
13.7
(-2.2)
15.2
(-1.5)
14
No Scale

Warning: fopen(./gnuplot/179185_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 17
1 2 3 4 range
A 4
(-1.2)
A
1.1
(-2.9)
A
1
(-3)
A
11.1
(3)
P
10
B 7
(3)
A
0.9
(-3)
A
5.9
(1.9)
A
4.2
(0.2)
A
6
C 17.6
(3)
A
0.9
(-3)
A
1.7
(-2.7)
A
3.4
(-2.1)
A
17
avr 9.5
(3)
1
(-3)
2.9
(-1.7)
6.2
(0.7)
9

Warning: fopen(./gnuplot/179185_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/179185_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 9
1 2 3 4 5 6 range
A 1.3
(-2.8)
A
10
(3)
A
1.2
(-2.9)
A
5.9
(0.3)
A
1
(-3)
A
9.1
(2.4)
A
9
B 3.8
(-1.3)
A
9.1
(3)
A
4.5
(-0.7)
A
1.7
(-3)
A
6.5
(0.9)
A
2.2
(-2.6)
A
7
C 6.5
(0.8)
A
0.8
(-2.9)
A
9.8
(3)
A
9.3
(2.7)
A
7
(1.2)
A
0.7
(-3)
A
9
avr 3.9
(-3)
6.6
(3)
5.2
(-0.1)
5.6
(0.8)
4.8
(-1)
4
(-2.8)
3
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 179185_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13727
Sequence Type Exemplar sequence
Representative Public ID F40D4.2 NCBI
Target Description F40D4.2 /REP_DB=WormBase Gene ID /WP=CE19836 /TR=Q9U3G3 /GB=CAB63199.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074948(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074948 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-155) (srh-155) mRNA, complete cds. 11/11 A 
F40D4.2 ENSEMBL cdna:known chromosome:CEL140:V:17182727:17184134:1 gene:F40D4.2 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:17182726-17184134(+) 100.0 100.0
chrV:17443132-17444351(+) 93.55 93.55
Public Domain and Genome References
Gene Title
Gene Symbol srh-155
Ensembl F40D4.2
Entrez Gene 185520 Entrez gene
SwissProt Q9U3G3 EMBL-EBI
WormBase CE19836 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB63199 Hypothetical protein F40D4.2 [Caenorhabditis elegans] ref|NP_507349.1| Serpentine Receptor, class H family member (srh-155) [Caenorhabditis elegans] 0.0
blast CAB04149 Hypothetical protein F20E11.12 [Caenorhabditis elegans] ref|NP_507412.1| Serpentine Receptor, class H family member (srh-154) [Caenorhabditis elegans] 1.0E-174
blast CAB63200 Hypothetical protein F40D4.3 [Caenorhabditis elegans] ref|NP_507350.1| Serpentine Receptor, class H family member (srh-159) [Caenorhabditis elegans] 1.0E-118
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_507349.1 6 53-75,95-117,138-160,197-219,240-262,277-296
F40D4.2 6 53-75,95-117,138-160,197-219,240-262,277-296
Sequence
Target Sequence
>C. ELEGANS:179185_AT
attgtaccgattactgtttgtcacagctaattatgtttatgctacattgtaccctactcc
cttatactttttccttcccgaccaaaagtatggaaaatttgtatcgaaaagtaaaaatcc
atgtatttcgagcgaatatttagaccatcccaatttctttttgcttgatctcgatggaaa
gtatacttcgatttgtatcctgctcatgttgagttctctggtctctcaaatgtttttgca
aattggactgattttccgtcagttgctcaaaaacccttccatttctcaaaatacgcaccg
actacaatatcagtttttaattgcgatgagcttgcaaggcatcattccaatgattatcat
cgtttttccagcttttttctatgttgtctcaattgtgttaaattatcataatcaaggtgc
aaacaacttgtcgtttcttttaatttccatgcatggagttctatcaacgttgacaatgct
catggcacacagaccttatagacaatcaattgtcaaaatgttgaatctgaaattcaataa
ggcgggtggtggtgt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATTGTACCGATTACTGTTTGTCACA 279 5 414 Antisense
AAAAATCCATGTATTTCGAGCGAAT 427 129 526 Antisense
TCGAGCGAATATTTAGACCATCCCA 305 603 541 Antisense
TAGACCATCCCAATTTCTTTTTGCT 351 653 554 Antisense
TACTTCGATTTGTATCCTGCTCATG 540 645 597 Antisense
TCGATTTGTATCCTGCTCATGTTGA 186 603 601 Antisense
AATATCAGTTTTTAATTGCGATGAG 614 173 719 Antisense
AAGGTGCAAACAACTTGTCGTTTCT 653 159 827 Antisense
TGCAAACAACTTGTCGTTTCTTTTA 33 577 831 Antisense
GCACACAGACCTTATAGACAATCAA 395 317 898 Antisense
AATTCAATAAGGCGGGTGGTGGTGT 705 167 944 Antisense
Sequence Source Affymetrix Proprietary Database