[Home] | [Total List]

[178524_at]

Description F26D2.4 /REP_DB=WormBase Gene ID /WP=CE15906 /TR=O45403 /GB=CAB04175.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 80      4grp_total > 40      6grp_cgc > 95      6grp_cgc_sub > 04      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/178524_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 24
1 2 3 4 range
A 8.3
(1.3)
A
10.9
(3)
A
1.5
(-3)
A
5.1
(-0.7)
A
9
B 2.1
(-2.8)
A
6.8
(-1.6)
A
24.9
(3)
A
1.3
(-3)
A
24
C 3.1
(-3)
A
3.1
(-3)
A
10.1
(0.3)
A
16
(3)
A
13
avr 4.5
(-3)
6.9
(-1.1)
12.2
(3)
7.5
(-0.7)
8

Warning: fopen(./gnuplot/178524_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 40
1 2 3 4 5 6 range
A 2.6
(-2)
A
1.5
(-3)
A
3.9
(-0.9)
A
1.9
(-2.6)
A
8.3
(3)
A
1.7
(-2.8)
A
7
B 2.7
(3)
A
1.5
(-2.5)
A
1.8
(-1.2)
A
1.4
(-3)
A
2.1
(0.2)
A
2.1
(0.2)
A
1
C 5.5
(-2.3)
A
1.6
(-2.9)
A
1.9
(-2.8)
A
40.5
(3)
A
2.1
(-2.8)
A
0.9
(-3)
A
40
avr 3.6
(-2)
1.5
(-3)
2.5
(-2.5)
14.6
(3)
4.2
(-1.8)
1.6
(-3)
13
No Scale

Warning: fopen(./gnuplot/178524_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 6
1 2 3 4 range
A 3
(3)
A
2.4
(1.6)
A
0.4
(-3)
A
0.7
(-2.3)
A
3
B 0.7
(-2.6)
A
1.7
(-1.5)
A
5.8
(3)
A
0.3
(-3)
A
6
C 1
(-2.8)
A
0.9
(-3)
A
3.5
(3)
A
2.7
(1.2)
A
3
avr 1.6
(-1.8)
1.7
(-1.5)
3.2
(3)
1.2
(-3)
2

Warning: fopen(./gnuplot/178524_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178524_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 8
1 2 3 4 5 6 range
A 0.5
(-2.7)
A
0.6
(-2.4)
A
0.8
(-1.9)
A
0.5
(-2.7)
A
2.5
(3)
A
0.4
(-3)
A
2
B 0.9
(3)
A
0.5
(-1.8)
A
0.4
(-3)
A
0.4
(-3)
A
0.9
(3)
A
0.8
(1.8)
A
1
C 2
(-1.7)
A
0.5
(-2.8)
A
0.5
(-2.8)
A
8.1
(3)
A
0.7
(-2.7)
A
0.3
(-3)
A
8
avr 1.1
(-1.6)
0.5
(-3)
0.6
(-2.8)
3
(3)
1.4
(-0.8)
0.5
(-3)
3
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 178524_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13693
Sequence Type Exemplar sequence
Representative Public ID F26D2.4 NCBI
Target Description F26D2.4 /REP_DB=WormBase Gene ID /WP=CE15906 /TR=O45403 /GB=CAB04175.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074746(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074746 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-145) (srh-145) mRNA, complete cds. 11/11 None
SNAP00000037734 ENSEMBL cdna:SNAP chromosome:CEL140:V:16413532:16414426:1 11/11 None
GENEFINDER00000037746 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:16413296:16417830:1 11/11 None
F26D2.4 ENSEMBL cdna:known chromosome:CEL140:V:16413296:16414426:1 gene:F26D2.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000037736 1/11 Cross Hyb Matching Probes None
F26D2.8 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:16413295-16414426(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol srh-145
Ensembl F26D2.4
Entrez Gene 184961 Entrez gene
SwissProt O45403 EMBL-EBI
WormBase CE15906 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6835 dicarboxylic acid transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
17153 sodium:dicarboxylate symporter activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB04175 Hypothetical protein F26D2.4 [Caenorhabditis elegans] ref|NP_507147.1| Serpentine Receptor, class H family member (srh-145) [Caenorhabditis elegans] 1.0E-160
blast T21401 hypothetical protein F26D2.5 - Caenorhabditis elegans 1.0E-131
blast CAB04175 Hypothetical protein F26D2.4 [Caenorhabditis elegans] ref|NP_507147.1| Serpentine Receptor, class H family member (srh-145) [Caenorhabditis elegans] 1.0E-115
blast CAB04175 Hypothetical protein F26D2.4 [Caenorhabditis elegans] ref|NP_507147.1| Serpentine Receptor, class H family member (srh-145) [Caenorhabditis elegans] 1.0E-103
blast CAB05794 Hypothetical protein T08G3.3 [Caenorhabditis elegans] ref|NP_507163.1| Serpentine Receptor, class H family member (srh-142) [Caenorhabditis elegans] 8.0E-91
blast T21401 hypothetical protein F26D2.5 - Caenorhabditis elegans 2.0E-90
blast T21401 hypothetical protein F26D2.5 - Caenorhabditis elegans 3.0E-88
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 5.3E-102
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.4E-56
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.3E-63
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.6E-28
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_507147.1 7 15-37,58-80,95-117,139-158,195-217,243-265,275-297
F26D2.4 7 15-37,58-80,95-117,139-158,195-217,243-265,275-297
SNAP00000037734 4 35-54,91-113,139-161,171-193
GENEFINDER00000037746 12 15-37,58-80,95-117,139-158,195-217,237-259,274-296,317-336,404-426,446-468,483-505,517-539
Sequence
Target Sequence
>C. ELEGANS:178524_AT
tagtccgtactgattctacaagtcaaagtcggaagatcaaacgagtcatccaacatttca
tcaattatcttctcgcattcctagcattccttccagctgcactagaagatccagatattg
ccagagctcgtgaatatgctcgtcaaaaacttccatgtttccccccgcaaatcatcgata
gctctcgattttttatactaggaactgatacaactcttttcttattgggagtgatccctt
ttctaatcattggctggacacaaattgcaacatttttcattagaacttctagatatatct
acaaaaccaaggcccaatccgagaggacttcaagtatgcagaaacaatttttcaaatccc
tctgtattcaaattgcaatacctgtagtaattatattaatccccggaggatatgtaattt
atacaagtgtcagtggtaatttcgacttggctttaacccatatttcaattatttggattt
caactcatggactatttgcaactgttgtgat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TAGTCCGTACTGATTCTACAAGTCA 622 651 383 Antisense
AAACGAGTCATCCAACATTTCATCA 277 127 421 Antisense
CATTTCATCAATTATCTTCTCGCAT 545 215 436 Antisense
GATCCAGATATTGCCAGAGCTCGTG 620 415 490 Antisense
TATGCTCGTCAAAAACTTCCATGTT 129 655 517 Antisense
CCCCGCAAATCATCGATAGCTCTCG 111 261 545 Antisense
GCTCTCGATTTTTTATACTAGGAAC 410 299 563 Antisense
GAACTGATACAACTCTTTTCTTATT 69 349 584 Antisense
GGGAGTGATCCCTTTTCTAATCATT 7 497 609 Antisense
ATTGGCTGGACACAAATTGCAACAT 140 3 631 Antisense
ATGGACTATTTGCAACTGTTGTGAT 235 53 869 Antisense
Sequence Source Affymetrix Proprietary Database