[Home] | [Total List]

[178462_at]

Description T15D6.5 /REP_DB=WormBase Gene ID /WP=CE13688 /TR=Q9XU74 /GB=CAB05616.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 05      4grp_total > 09      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/178462_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 67
1 2 3 4 range
A 2.7
(-3)
A
9.4
(-2.4)
A
19.8
(-1.4)
A
68.7
(3)
A
66
B 6.9
(-3)
A
8.2
(-2.7)
A
8.6
(-2.7)
A
37.7
(3)
A
31
C 8
(-2.7)
A
19.7
(-1.7)
A
5.3
(-3)
A
69.4
(3)
A
64
avr 5.9
(-3)
12.4
(-2.3)
11.2
(-2.4)
58.6
(3)
53

Warning: fopen(./gnuplot/178462_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 29
1 2 3 4 5 6 range
A 30.5
(3)
A
3
(-3)
A
20.2
(0.8)
A
5.3
(-2.5)
A
7.5
(-2)
A
4.7
(-2.6)
A
28
B 5.4
(-3)
A
17.6
(3)
A
5.3
(-3)
A
8.5
(-1.4)
A
11.9
(0.2)
A
5.5
(-2.9)
A
12
C 3.5
(-1.2)
A
8.1
(3)
A
1.5
(-3)
A
6.2
(1.3)
A
3.2
(-1.5)
A
5
(0.2)
A
7
avr 13.1
(3)
9.6
(0.4)
9
(-0.1)
6.7
(-1.8)
7.5
(-1.2)
5.1
(-3)
8
No Scale

Warning: fopen(./gnuplot/178462_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 11
1 2 3 4 range
A 1
(-3)
A
2
(-2.3)
A
5.2
(-0.2)
A
10.1
(3)
A
9
B 2.2
(-2.8)
A
2
(-3)
A
2
(-3)
A
8
(3)
A
6
C 2.6
(-2.5)
A
5.7
(-0.6)
A
1.8
(-3)
A
11.7
(3)
A
10
avr 1.9
(-3)
3.2
(-2)
3
(-2.2)
9.9
(3)
8

Warning: fopen(./gnuplot/178462_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178462_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 6
1 2 3 4 5 6 range
A 5.6
(3)
A
1.1
(-3)
A
4.4
(1.4)
A
1.3
(-2.7)
A
2.3
(-1.4)
A
1.1
(-3)
A
5
B 1.9
(-2.2)
A
5.9
(3)
A
1.3
(-3)
A
2.3
(-1.7)
A
4.8
(1.6)
A
2.1
(-2)
A
5
C 1.3
(-0.4)
A
2.5
(3)
A
0.4
(-3)
A
1.2
(-0.7)
A
1
(-1.3)
A
1.7
(0.7)
A
2
avr 2.9
(1.9)
3.2
(3)
2
(-1.5)
1.6
(-3)
2.7
(1.1)
1.6
(-3)
2
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 178462_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1102
Sequence Type Exemplar sequence
Representative Public ID T15D6.5 NCBI
Target Description T15D6.5 /REP_DB=WormBase Gene ID /WP=CE13688 /TR=Q9XU74 /GB=CAB05616.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060735(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060735 NCBI Caenorhabditis elegans T15D6.5 (T15D6.5) mRNA, complete cds. 11/11 None
GENEFINDER00000012754 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:12389930:12391381:1 10/11 None
SNAP00000012744 ENSEMBL cdna:SNAP chromosome:CEL140:I:12389972:12391381:1 10/11 None
T15D6.5 ENSEMBL cdna:known chromosome:CEL140:I:12389930:12391381:1 gene:T15D6.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:12389860-12391312(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl T15D6.5
Entrez Gene 188532 Entrez gene
SwissProt Q9XU74 EMBL-EBI
WormBase CE13688 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6486 protein amino acid glycosylation inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
8378 galactosyltransferase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05616 Hypothetical protein T15D6.5 [Caenorhabditis elegans] ref|NP_493136.1| T15D6.5 [Caenorhabditis elegans] 0.0
blast CAA15841 Hypothetical protein C47F8.3 [Caenorhabditis elegans] emb|CAB04502.1| Hypothetical protein C47F8.3 [Caenorhabditis elegans] ref|NP_493113.1| C47F8.3 [Caenorhabditis elegans] 1.0E-104
blast CAA15841 Hypothetical protein C47F8.3 [Caenorhabditis elegans] emb|CAB04502.1| Hypothetical protein C47F8.3 [Caenorhabditis elegans] ref|NP_493113.1| C47F8.3 [Caenorhabditis elegans] 1.0E-99
blast CAA15838 Hypothetical protein C47F8.5 [Caenorhabditis elegans] ref|NP_493116.2| C47F8.5 [Caenorhabditis elegans] 7.0E-86
Protein Domains
Database ID Description E-Value
Pfam IPR002659 EMBL-EBI Glycosyl transferase, family 31 9.0E-92
Pfam IPR002659 EMBL-EBI Glycosyl transferase, family 31 9.0E-92
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_493136.1 1 47-64
T15D6.5 1 47-64
GENEFINDER00000012754 1 47-64
SNAP00000012744 1 33-50
Sequence
Target Sequence
>C. ELEGANS:178462_AT
aacttgccgttcaaggtgctatccctacttctttatggaacaaataaggcgtccgatttc
aaaattattggaaaaatcgacgatgacgtcattttcttcccggaccgtcttaccccactg
ttggacgaaaacgtgattgattccagcagctatagcatctacgggtacttgtcacaagat
gatgagcttgtcgttcgaaacgaaactaaaccatggtatgtacctgaaactgcatataac
tgcacgaaatatccggtgtacgctttgggaccattttatttgatcactaacaaggcagct
aatcttatcgtggaaaattccagatttcaaaatttcatgacagttgaagacgctcttatc
gctggaattattgccgagggtcttggaattcagcggcacagtcttccaatgaacactgac
ggaaagaaaattctctcgtggcatatgtccaaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AACTTGCCGTTCAAGGTGCTATCCC 396 137 619 Antisense
GTGCTATCCCTACTTCTTTATGGAA 664 479 634 Antisense
AAACGTGATTGATTCCAGCAGCTAT 194 127 747 Antisense
AGCATCTACGGGTACTTGTCACAAG 710 77 772 Antisense
TATCCGGTGTACGCTTTGGGACCAT 451 657 868 Antisense
GGGACCATTTTATTTGATCACTAAC 461 495 885 Antisense
GAAGACGCTCTTATCGCTGGAATTA 440 339 964 Antisense
CGCTGGAATTATTGCCGAGGGTCTT 371 255 978 Antisense
CGAGGGTCTTGGAATTCAGCGGCAC 123 251 993 Antisense
TTCAGCGGCACAGTCTTCCAATGAA 338 687 1007 Antisense
ATTCTCTCGTGGCATATGTCCAAAA 252 11 1048 Antisense
Sequence Source Affymetrix Proprietary Database