[Home] | [Total List]

[178278_at]

Description T15D6.7 /REP_DB=WormBase Gene ID /WP=CE13692 /TR=Q9XU73 /GB=CAB05617.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 02      4grp_total > 11      

Scale

Warning: fopen(./gnuplot/178278_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 83
1 2 3 4 range
A 4.2
(-3)
A
16.7
(-0.7)
A
4.5
(-2.9)
A
36.3
(3)
A
32
B 16.7
(3)
A
5.1
(-1.8)
A
2.1
(-3)
A
4.8
(-1.9)
A
15
C 3.2
(-3)
A
5
(-2.8)
A
2.9
(-3)
A
85.2
(3)
A
82
avr 8
(-2.3)
8.9
(-2.1)
3.2
(-3)
42.1
(3)
39

Warning: fopen(./gnuplot/178278_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 50
1 2 3 4 5 6 range
A 18.1
(3)
A
4.8
(-2.1)
A
2.6
(-3)
A
5.4
(-1.9)
A
4.7
(-2.2)
A
2.7
(-3)
A
16
B 1.2
(-3)
A
7.6
(-1)
A
13
(0.7)
A
4
(-2.1)
A
20.3
(3)
A
2.9
(-2.5)
A
19
C 5
(-2.6)
A
51.4
(3)
A
4.5
(-2.7)
A
11.4
(-1.8)
A
5.6
(-2.5)
A
1.6
(-3)
A
50
avr 8.1
(-1.2)
21.3
(3)
6.7
(-1.6)
6.9
(-1.6)
10.2
(-0.5)
2.4
(-3)
19
No Scale

Warning: fopen(./gnuplot/178278_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 14
1 2 3 4 range
A 1.5
(-2.6)
A
3.6
(0.5)
A
1.2
(-3)
A
5.3
(3)
A
4
B 5.3
(3)
A
1.3
(-2)
A
0.5
(-3)
A
1
(-2.4)
A
5
C 1.1
(-3)
A
1.4
(-2.8)
A
1
(-3)
A
14.4
(3)
A
13
avr 2.6
(-1.3)
2.1
(-1.8)
0.9
(-3)
6.9
(3)
6

Warning: fopen(./gnuplot/178278_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178278_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 15
1 2 3 4 5 6 range
A 3.3
(3)
A
1.7
(-0.6)
A
0.6
(-3)
A
1.4
(-1.2)
A
1.4
(-1.2)
A
0.7
(-2.8)
A
3
B 0.4
(-3)
A
2.5
(-1.4)
A
3.1
(-0.9)
A
1.1
(-2.5)
A
8.3
(3)
A
1.1
(-2.5)
A
8
C 1.8
(-2.5)
A
15.7
(3)
A
1.1
(-2.8)
A
2.3
(-2.3)
A
1.8
(-2.5)
A
0.5
(-3)
A
15
avr 1.8
(-2)
6.6
(3)
1.6
(-2.2)
1.6
(-2.2)
3.8
(0.1)
0.8
(-3)
6
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 178278_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1308
Sequence Type Exemplar sequence
Representative Public ID T15D6.7 NCBI
Target Description T15D6.7 /REP_DB=WormBase Gene ID /WP=CE13692 /TR=Q9XU73 /GB=CAB05617.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060737(11), AJ972875(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060737 NCBI Caenorhabditis elegans T15D6.7 (T15D6.7) mRNA, complete cds. 11/11 None
AJ972875 NCBI Caenorhabditis elegans mRNA for beta-1,3-glucuronosyltransferase (nglcat2 gene), splice variant 1. 11/11 None
SNAP00000012746 ENSEMBL cdna:SNAP chromosome:CEL140:I:12395951:12396913:1 11/11 None
GENEFINDER00000012753 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:12395951:12396913:1 11/11 None
T15D6.7 ENSEMBL cdna:known chromosome:CEL140:I:12395951:12396913:1 gene:T15D6.7 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:12395881-12396844(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl T15D6.7
Entrez Gene 188533 Entrez gene
SwissProt Q9XU73 EMBL-EBI
WormBase CE13692 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
15018 galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAI99633 beta-1,3-glucuronosyltransferase [Caenorhabditis elegans] 1.0E-165
blast CAB05617 Hypothetical protein T15D6.7 [Caenorhabditis elegans] ref|NP_493138.1| T15D6.7 [Caenorhabditis elegans] 1.0E-157
blast CAB05617 Hypothetical protein T15D6.7 [Caenorhabditis elegans] ref|NP_493138.1| T15D6.7 [Caenorhabditis elegans] 1.0E-151
blast CAB05617 Hypothetical protein T15D6.7 [Caenorhabditis elegans] ref|NP_493138.1| T15D6.7 [Caenorhabditis elegans] 1.0E-144
blast CAI99633 beta-1,3-glucuronosyltransferase [Caenorhabditis elegans] 1.0E-140
blast CAB05617 Hypothetical protein T15D6.7 [Caenorhabditis elegans] ref|NP_493138.1| T15D6.7 [Caenorhabditis elegans] 1.0E-140
blast CAI99633 beta-1,3-glucuronosyltransferase [Caenorhabditis elegans] 1.0E-135
blast CAI99633 beta-1,3-glucuronosyltransferase [Caenorhabditis elegans] 1.0E-134
Protein Domains
Database ID Description E-Value
Pfam IPR005027 EMBL-EBI Glycosyl transferase, family 43 1.0E-126
Pfam IPR005027 EMBL-EBI Glycosyl transferase, family 43 2.1E-112
Pfam IPR005027 EMBL-EBI Glycosyl transferase, family 43 9.6E-11
Pfam IPR005027 EMBL-EBI Glycosyl transferase, family 43 1.0E-126
Pfam IPR005027 EMBL-EBI Glycosyl transferase, family 43 1.0E-126
Sequence
Target Sequence
>C. ELEGANS:178278_AT
gtatacctatgtagcgcaccgaactgcttcaggataccctgcccgaggatggtaccagcg
agatatggcattaaagttgatacggacaaacccatcccaaatcctgggtgagcatgaggg
agaagctgtgatttattttgcagacgatgataattcttacgacttgcgactatttgagga
ttatatcaggaatgtgaagaagctgggtctttgggctgttggcttggctggtggagcagc
agtggaggctccaaacgtagtgaacaagaaagtcacttcattcaatttcaagtggaaatc
caagcgacgattcgctgttgatatggcgggatttgcaatcaatcttgactatatcctaaa
ttccagtgcagtgttcggtacggaatgtaagagaggtgatggcgctccggagacttgtct
cctcgaggatctaggtttcgatttgaatgatattgaaccttttgggtatgagaaagaggc
aagtgaaatttatagtagtttatatagtatggtattttatttacagaaaaacaatgagat
cttggtatggcacactaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTATACCTATGTAGCGCACCGAACT 88 447 264 Antisense
GCACCGAACTGCTTCAGGATACCCT 426 315 279 Antisense
CTGCCCGAGGATGGTACCAGCGAGA 57 237 302 Antisense
GTTGATACGGACAAACCCATCCCAA 216 401 339 Antisense
AATTCTTACGACTTGCGACTATTTG 515 175 415 Antisense
AGAAGCTGGGTCTTTGGGCTGTTGG 653 71 461 Antisense
GTGGAGGCTCCAAACGTAGTGAACA 338 489 505 Antisense
AATTCCAGTGCAGTGTTCGGTACGG 544 177 622 Antisense
TAAGAGAGGTGATGGCGCTCCGGAG 227 637 651 Antisense
GACTTGTCTCCTCGAGGATCTAGGT 407 371 675 Antisense
ATGAGATCTTGGTATGGCACACTAA 422 45 797 Antisense
Sequence Source Affymetrix Proprietary Database