[Home] | [Total List]

[178270_s_at]

Description T27C5.3 /REP_DB=WormBase Gene ID /WP=CE16497 /TR=O45847 /GB=CAB04864.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 54      4grp_total > 03      6grp_cgc > 91      6grp_cgc_sub > 03      

Scale

Warning: fopen(./gnuplot/178270_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 35
1 2 3 4 range
A 8.2
(3)
A
2.2
(-3)
A
2.5
(-2.7)
A
4.1
(-1.1)
A
6
B 1.2
(-3)
A
3.3
(-0.3)
A
3.1
(-0.6)
A
5.9
(3)
A
5
C 1
(-2.9)
A
3.1
(-2.6)
A
0.7
(-3)
A
35.9
(3)
A
35
avr 3.5
(-2.4)
2.9
(-2.6)
2.1
(-3)
15.3
(3)
13

Warning: fopen(./gnuplot/178270_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 30
1 2 3 4 5 6 range
A 2.5
(-1.1)
A
4.3
(0.8)
A
0.8
(-3)
A
3.6
(0.1)
A
6.3
(3)
A
4.5
(1)
A
6
B 11.3
(3)
A
1.9
(-2.4)
A
4.9
(-0.7)
A
0.8
(-3)
A
3.1
(-1.7)
A
4.3
(-1)
A
11
C 1.5
(-3)
A
4.2
(-2.4)
A
30.8
(3)
A
7
(-1.9)
A
2.3
(-2.8)
A
13.3
(-0.6)
A
29
avr 5.1
(-1.9)
3.5
(-3)
12.2
(3)
3.8
(-2.8)
3.9
(-2.7)
7.4
(-0.3)
9
No Scale

Warning: fopen(./gnuplot/178270_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 6
1 2 3 4 range
A 3
(3)
A
0.5
(-3)
A
0.7
(-2.5)
A
0.6
(-2.8)
A
3
B 0.4
(-3)
A
0.8
(-0.3)
A
0.7
(-1)
A
1.3
(3)
A
1
C 0.3
(-2.9)
A
0.9
(-2.3)
A
0.2
(-3)
A
6.1
(3)
A
6
avr 1.2
(-1.1)
0.7
(-2.5)
0.5
(-3)
2.7
(3)
2

Warning: fopen(./gnuplot/178270_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/178270_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 8
1 2 3 4 5 6 range
A 0.5
(-1.9)
A
1.5
(1.6)
A
0.2
(-3)
A
0.9
(-0.5)
A
1.9
(3)
A
1.1
(0.2)
A
2
B 3.9
(3)
A
0.6
(-2.4)
A
1.2
(-1.4)
A
0.2
(-3)
A
1.2
(-1.4)
A
1.6
(-0.7)
A
4
C 0.5
(-3)
A
1.3
(-2.3)
A
7.8
(3)
A
1.4
(-2.3)
A
0.7
(-2.8)
A
4.5
(0.3)
A
7
avr 1.6
(-0.9)
1.1
(-2.2)
3.1
(3)
0.8
(-3)
1.3
(-1.7)
2.4
(1.2)
2
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 178270_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13816
Sequence Type Exemplar sequence
Representative Public ID T27C5.3 NCBI
Target Description T27C5.3 /REP_DB=WormBase Gene ID /WP=CE16497 /TR=O45847 /GB=CAB04864.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_075000(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_075000 NCBI Caenorhabditis elegans Serpentine Receptor, class X family member (srx-53) (srx-53) mRNA, complete cds. 11/11 None
SNAP00000030289 ENSEMBL cdna:SNAP chromosome:CEL140:V:17402855:17404351:-1 10/11 None
SNAP00000030290 ENSEMBL cdna:SNAP chromosome:CEL140:V:17405101:17406608:1 11/11 None
GENEFINDER00000030301 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:17402700:17404351:-1 11/11 None
T27C5.2 ENSEMBL cdna:known chromosome:CEL140:V:17402040:17404351:-1 gene:T27C5.2 11/11 None
T27C5.3 ENSEMBL cdna:pseudogene chromosome:CEL140:V:17405101:17406763:1 gene:T27C5.3 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:17405727-17406591(+) 79.5 100.0
Public Domain and Genome References
Gene Title
Gene Symbol srx-53
Ensembl T27C5.2
T27C5.3
Entrez Gene 188981 Entrez gene
SwissProt O45846 EMBL-EBI
WormBase CE16496 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAA20963 Hypothetical protein Y102A5C.22 [Caenorhabditis elegans] ref|NP_507293.2| Serpentine Receptor, class X family member (srx-54) [Caenorhabditis elegans] 1.0E-132
blast CAA20963 Hypothetical protein Y102A5C.22 [Caenorhabditis elegans] ref|NP_507293.2| Serpentine Receptor, class X family member (srx-54) [Caenorhabditis elegans] 1.0E-127
blast CAB04863 Hypothetical protein T27C5.2 [Caenorhabditis elegans] ref|NP_507401.1| Serpentine Receptor, class X family member (srx-53) [Caenorhabditis elegans] 1.0E-124
blast CAB04863 Hypothetical protein T27C5.2 [Caenorhabditis elegans] ref|NP_507401.1| Serpentine Receptor, class X family member (srx-53) [Caenorhabditis elegans] 1.0E-108
blast CAB03338 Hypothetical protein T10H4.9 [Caenorhabditis elegans] ref|NP_506786.2| Serpentine Receptor, class X family member (srx-51) [Caenorhabditis elegans] 2.0E-98
blast AAP86615 Serpentine receptor, class x protein 50, isoform b [Caenorhabditis elegans] ref|NP_001023464.1| Serpentine Receptor, class X family member (srx-50) [Caenorhabditis elegans] 1.0E-96
blast CAB03338 Hypothetical protein T10H4.9 [Caenorhabditis elegans] ref|NP_506786.2| Serpentine Receptor, class X family member (srx-51) [Caenorhabditis elegans] 3.0E-96
blast AAP86615 Serpentine receptor, class x protein 50, isoform b [Caenorhabditis elegans] ref|NP_001023464.1| Serpentine Receptor, class X family member (srx-50) [Caenorhabditis elegans] 6.0E-95
blast CAA20963 Hypothetical protein Y102A5C.22 [Caenorhabditis elegans] ref|NP_507293.2| Serpentine Receptor, class X family member (srx-54) [Caenorhabditis elegans] 3.0E-54
Protein Domains
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_507401.1 4 7-29,49-68,127-149,159-181
T27C5.2 4 7-29,49-68,127-149,159-181
SNAP00000030289 6 7-28,48-70,77-99,114-136,148-165,170-188
SNAP00000030290 6 7-29,49-71,78-100,120-142,154-171,176-195
GENEFINDER00000030301 4 7-29,49-68,127-149,159-181
Sequence
Target Sequence
>C. ELEGANS:178270_S_AT
tcatcccagtcggcaaagaagacacattttgaaatgagttttctgaagcaggcatgtctt
caggcgtttgtatttacttgcgagcttgttacgtatttcctgataactcccagaattgat
ccaaccgaaaaatggattcgattcattctatcgacagttgcatg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCATCCCAGTCGGCAAAGAAGACAC 667 621 337 Antisense
ATGAGTTTTCTGAAGCAGGCATGTC 104 47 370 Antisense
GAAGCAGGCATGTCTTCAGGCGTTT 650 341 381 Antisense
GCATGTCTTCAGGCGTTTGTATTTA 345 311 388 Antisense
GGCGTTTGTATTTACTTGCGAGCTT 443 539 399 Antisense
ACTTGCGAGCTTGTTACGTATTTCC 610 103 412 Antisense
GCGAGCTTGTTACGTATTTCCTGAT 605 289 416 Antisense
TGTTACGTATTTCCTGATAACTCCC 694 561 423 Antisense
CCAGAATTGATCCAACCGAAAAATG 160 273 446 Antisense
AAAATGGATTCGATTCATTCTATCG 257 133 465 Antisense
GATTCATTCTATCGACAGTTGCATG 664 429 476 Antisense
Sequence Source Affymetrix Proprietary Database