[Home] | [Total List]

[177831_at] G-protein coupled receptor, srh family

Description R08H2.4 /REP_DB=WormBase Gene ID /WP=CE12600 /TR=O17987 /GB=CAB04630.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 30      4grp_total > 13      6grp_cgc > 73      6grp_cgc_sub > 02_03      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/177831_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 115
1 2 3 4 range
A 55
(-0.7)
A
13
(-3)
A
38.8
(-1.6)
A
123.4
(3)
A
110
B 62.9
(3)
A
31.7
(-3)
A
44.3
(-0.6)
A
34.5
(-2.5)
A
31
C 55.9
(-0)
A
66.7
(0.7)
A
8.9
(-3)
A
103.5
(3)
P
95
avr 57.9
(-0.1)
37.1
(-2.3)
30.7
(-3)
87.1
(3)
56

Warning: fopen(./gnuplot/177831_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 60
1 2 3 4 5 6 range
A 34.6
(-0.1)
A
29.2
(-0.9)
A
54.5
(3)
A
52.4
(2.7)
A
53.5
(2.8)
A
15.9
(-3)
A
39
B 18.5
(-1.4)
A
38.8
(1.5)
A
39.6
(1.6)
A
49.8
(3)
A
11.3
(-2.4)
A
6.8
(-3)
A
43
C 25.6
(-1.4)
A
67.2
(3)
A
26.8
(-1.2)
A
39
(0)
A
12.5
(-2.7)
A
10
(-3)
A
57
avr 26.2
(-0.5)
45.1
(2.7)
40.3
(1.9)
47.1
(3)
25.8
(-0.5)
10.9
(-3)
36
No Scale

Warning: fopen(./gnuplot/177831_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 17
1 2 3 4 range
A 20
(3)
A
2.8
(-3)
A
10.1
(-0.5)
A
18.1
(2.3)
A
17
B 20.1
(3)
A
7.8
(-2.8)
A
10.3
(-1.6)
A
7.3
(-3)
A
13
C 18.5
(2.7)
A
19.2
(3)
A
3.1
(-3)
A
17.5
(2.4)
P
16
avr 19.5
(3)
9.9
(-1.9)
7.8
(-3)
14.3
(0.3)
12

Warning: fopen(./gnuplot/177831_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177831_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 18
1 2 3 4 5 6 range
A 6.4
(-1.8)
A
10.4
(0.2)
A
11.9
(0.9)
A
13.3
(1.6)
A
16.2
(3)
A
3.9
(-3)
A
12
B 6.4
(-0.8)
A
12.9
(2.8)
A
9.6
(1)
A
13.2
(3)
A
4.6
(-1.8)
A
2.5
(-3)
A
11
C 9.5
(-0.8)
A
20.5
(3)
A
6.8
(-1.8)
A
7.8
(-1.4)
A
4.1
(-2.7)
A
3.3
(-3)
A
17
avr 7.4
(-0.8)
14.6
(3)
9.4
(0.3)
11.4
(1.3)
8.3
(-0.3)
3.2
(-3)
11
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177831_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13839
Sequence Type Exemplar sequence
Representative Public ID R08H2.4 NCBI
Target Description R08H2.4 /REP_DB=WormBase Gene ID /WP=CE12600 /TR=O17987 /GB=CAB04630.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074418(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074418 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-251) (srh-251) mRNA, complete cds. 11/11 None
R08H2.4 ENSEMBL cdna:known chromosome:CEL140:V:15380953:15382503:-1 gene:R08H2.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
GENEFINDER00000012532 3/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:15380952-15382503(-) 100.0 100.0
Public Domain and Genome References
Gene Title G-protein coupled receptor, srh family
Gene Symbol srh-251
Ensembl R08H2.4
Entrez Gene 187711 Entrez gene
SwissProt O17987 EMBL-EBI
WormBase CE12600 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB04630 Hypothetical protein R08H2.4 [Caenorhabditis elegans] ref|NP_506819.1| Serpentine Receptor, class H family member (srh-251) [Caenorhabditis elegans] 1.0E-168
blast CAB07488 Hypothetical protein T19C9.3 [Caenorhabditis elegans] ref|NP_507362.1| Serpentine Receptor, class H family member (srh-252) [Caenorhabditis elegans] 1.0E-123
blast T20585 hypothetical protein F08E10.5 - Caenorhabditis elegans 1.0E-111
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 2.9E-124
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_506819.1 7 13-35,56-78,88-110,131-150,188-210,231-253,268-290
R08H2.4 7 13-35,56-78,88-110,131-150,188-210,231-253,268-290
Sequence
Target Sequence
>C. ELEGANS:177831_AT
accgattctacgctaccattggtcaaaactccatctggcaccacctccgaaaaatctatc
ttccactaatgtgcatttttcctcctatctcctctcttcccgtctggacaatcctgccgt
cacaggaaaatgctcgaccatgtgatgaaactttatttctggagaatattcatatggtca
ataagaaaatattcattttatctgttgatcctttagttattgtgttatggggcgttgttt
gttcatgtatcatcactatacctatcatttcatttttcactctcacattcttaaagcttc
tggagagacagagaaatcataagtattcatttcgaacaattcaaatgcagaagaattttc
tgttgtccatgtcaatccagtttggctcgtttctcatgctcattataatacccttaattc
tattgcatagctctgtcattttctggtttcattcccaagttcttaataatttcatcacaa
tcatgttctcatcattcggcactggatcccctgttgtcatgatttttgt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACCGATTCTACGCTACCATTGGTCA 579 87 350 Antisense
TGGTCAAAACTCCATCTGGCACCAC 564 551 369 Antisense
GCACCACCTCCGAAAAATCTATCTT 208 315 387 Antisense
GGGCGTTGTTTGTTCATGTATCATC 303 493 579 Antisense
CATTTTTCACTCTCACATTCTTAAA 630 213 620 Antisense
TTTCTGTTGTCCATGTCAATCCAGT 247 671 706 Antisense
TCAATCCAGTTTGGCTCGTTTCTCA 596 633 721 Antisense
GCATAGCTCTGTCATTTTCTGGTTT 596 307 774 Antisense
TTCTGGTTTCATTCCCAAGTTCTTA 245 695 790 Antisense
TGTTCTCATCATTCGGCACTGGATC 73 561 833 Antisense
GATCCCCTGTTGTCATGATTTTTGT 189 417 854 Antisense
Sequence Source Affymetrix Proprietary Database