[Home] | [Total List]

[177708_at]

Description C06C3.8 /REP_DB=WormBase Gene ID /WP=CE00889 /TR=Q17715 /GB=CAA85315.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 51      4grp_total > 01      6grp_total_sub > Hat      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/177708_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 146
1 2 3 4 range
A 18.5
(-2.8)
A
13.3
(-3)
A
23.3
(-2.6)
A
157.2
(3)
A
144
B 18.7
(-2.5)
A
10.9
(-3)
A
47
(-0.8)
A
107.3
(3)
A
96
C 44.5
(-1.3)
A
37.5
(-1.8)
A
21
(-3)
A
106.2
(3)
A
85
avr 27.2
(-2.6)
20.6
(-3)
30.4
(-2.4)
123.6
(3)
103

Warning: fopen(./gnuplot/177708_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 67
1 2 3 4 5 6 range
A 62.6
(2.2)
A
46.6
(0.5)
A
49.7
(0.8)
A
70.6
(3)
A
45.1
(0.4)
A
12.8
(-3)
A
58
B 52.8
(1.8)
A
29.5
(-0.8)
A
43.8
(0.8)
A
64.1
(3)
A
56.7
(2.2)
A
8.9
(-3)
A
55
C 42
(-2.1)
A
56.7
(0.1)
A
75.7
(3)
A
45.9
(-1.5)
A
47.6
(-1.3)
A
36.4
(-3)
A
39
avr 52.5
(1.9)
44.3
(0.7)
56.4
(2.4)
60.2
(3)
49.8
(1.5)
19.4
(-3)
41
No Scale

Warning: fopen(./gnuplot/177708_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 20
1 2 3 4 range
A 6.7
(-1.9)
A
2.9
(-3)
A
6.1
(-2)
A
23
(3)
A
20
B 6
(-2)
A
2.7
(-3)
A
10.9
(-0.6)
A
22.9
(3)
A
20
C 14.7
(1.2)
A
10.8
(-1)
A
7.3
(-3)
A
17.9
(3)
A
11
avr 9.1
(-1.6)
5.5
(-3)
8.1
(-2)
21.3
(3)
16

Warning: fopen(./gnuplot/177708_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177708_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 20
1 2 3 4 5 6 range
A 11.5
(0.4)
A
16.6
(2.5)
A
10.8
(0.1)
A
17.9
(3)
A
13.6
(1.3)
A
3.1
(-3)
A
15
B 18.4
(1.6)
A
9.8
(-1)
A
10.6
(-0.8)
A
17
(1.2)
A
23.1
(3)
A
3.3
(-3)
A
20
C 15.6
(0.8)
A
17.3
(1.8)
A
19.3
(3)
A
9.2
(-3)
A
15.4
(0.7)
A
12.2
(-1.2)
A
10
avr 15.2
(1.8)
14.6
(1.5)
13.6
(1)
14.7
(1.6)
17.4
(3)
6.2
(-3)
11
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177708_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.3693
Sequence Type Exemplar sequence
Representative Public ID C06C3.8 NCBI
Target Description C06C3.8 /REP_DB=WormBase Gene ID /WP=CE00889 /TR=Q17715 /GB=CAA85315.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_063600(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_063600 NCBI Caenorhabditis elegans C06C3.8 (C06C3.8) mRNA, complete cds. 11/11 None
SNAP00000008813 ENSEMBL cdna:SNAP chromosome:CEL140:II:9386500:9388251:-1 11/11 None
GENEFINDER00000008817 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:9386500:9392772:-1 11/11 None
C06C3.8 ENSEMBL cdna:known chromosome:CEL140:II:9386496:9390812:-1 gene:C06C3.8 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
C06C3.5 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:9386496-9390809(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl C06C3.8
Entrez Gene 174487 Entrez gene
SwissProt Q17715 EMBL-EBI
WormBase CE35824 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6508 proteolysis inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4176 ATP-dependent peptidase activity inferred from electronic annotation QuickGO AmiGO
4252 serine-type endopeptidase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA85315 Hypothetical protein C06C3.8 [Caenorhabditis elegans] ref|NP_496001.2| C06C3.8 [Caenorhabditis elegans] 0.0
blast CAA85315 Hypothetical protein C06C3.8 [Caenorhabditis elegans] ref|NP_496001.2| C06C3.8 [Caenorhabditis elegans] 1.0E-155
blast AAB70946 Hypothetical protein B0454.9 [Caenorhabditis elegans] ref|NP_494435.1| B0454.9 [Caenorhabditis elegans] 2.0E-52
blast AAB70946 Hypothetical protein B0454.9 [Caenorhabditis elegans] ref|NP_494435.1| B0454.9 [Caenorhabditis elegans] 6.0E-44
blast AAF39917 Hypothetical protein K08A2.4 [Caenorhabditis elegans] ref|NP_494417.1| K08A2.4 [Caenorhabditis elegans] 1.0E-28
Protein Domains
Database ID Description E-Value
Pfam IPR005020 EMBL-EBI Protein of unknown function DUF278 2.2E-10
Pfam IPR005020 EMBL-EBI Protein of unknown function DUF278 5.5E-17
Pfam IPR005020 EMBL-EBI Protein of unknown function DUF278 5.5E-17
Sequence
Target Sequence
>C. ELEGANS:177708_AT
tcaaacttgccaaggacggtctccgtaaccgcctgcgggactcaattaccgagaagctgc
acaatgaggcggacactgaaaaccacctctggcagtgggagttgtatgagttcatcagat
tctacagggagattactgaaggttgggaactccggatgagagcattagttgctaagaaac
acgaaggtcagctgagagtcagagagtcagctgagtgttcagatatgattaaggacgaca
agaatttgatcaatatcgatgatgaacgtaatatgaaacttgatcacgttcggactgata
tttccgacacaagcattgtacagacctgtatggactcttcgcgtctcccctctaatgatg
aacatcctggagcgaagccgacactgattcaccatacaacgccgtcactcgattgccagc
ctacaaaacatgaatctattcattcagacttctcaaaagaaatggatcaactcgtgaatc
aagcgacacggattgctcgcgagcatccggaacgtgcggagactttgctcaaggcgcttt
tcgctactgtgtc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCAAACTTGCCAAGGACGGTCTCCG 171 627 809 Antisense
GTAACCGCCTGCGGGACTCAATTAC 496 459 833 Antisense
AGCTGCACAATGAGGCGGACACTGA 396 81 863 Antisense
GACACTGAAAACCACCTCTGGCAGT 159 367 880 Antisense
TGAAACTTGATCACGTTCGGACTGA 400 571 1082 Antisense
GACTGATATTTCCGACACAAGCATT 492 375 1101 Antisense
TACAGACCTGTATGGACTCTTCGCG 288 643 1127 Antisense
CGTCTCCCCTCTAATGATGAACATC 212 247 1150 Antisense
CACGGATTGCTCGCGAGCATCCGGA 249 199 1295 Antisense
TGCGGAGACTTTGCTCAAGGCGCTT 391 583 1323 Antisense
TCAAGGCGCTTTTCGCTACTGTGTC 288 633 1337 Antisense
Sequence Source Affymetrix Proprietary Database