[Home] | [Total List]

[177674_at]

Description W05H5.4 /REP_DB=WormBase Gene ID /WP=CE25140 /TR=P91841 /GB=CAB03479.2 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 44      4grp_total > 19      6grp_cgc > 80      

Scale

Warning: fopen(./gnuplot/177674_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 74
1 2 3 4 range
A 21.3
(-3)
A
30.5
(-1.3)
A
26.8
(-2)
A
53.8
(3)
A
33
B 28.3
(-1.3)
A
58.3
(3)
A
16.3
(-3)
A
53.3
(2.3)
A
42
C 38.3
(-0.6)
A
8.3
(-3)
A
11
(-2.8)
A
81.9
(3)
A
74
avr 29.3
(-1.5)
32.4
(-1.1)
18
(-3)
63
(3)
45

Warning: fopen(./gnuplot/177674_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 48
1 2 3 4 5 6 range
A 49.5
(3)
A
28.8
(0.3)
A
22.5
(-0.5)
A
4.9
(-2.8)
A
6.3
(-2.6)
A
3.1
(-3)
A
46
B 1.3
(-3)
A
20.5
(-0.6)
A
48.7
(3)
A
2.8
(-2.8)
A
11.7
(-1.7)
A
16.8
(-1)
A
47
C 6.8
(-0.4)
A
7.4
(0.1)
A
10.7
(3)
A
4.4
(-2.6)
A
3.9
(-3)
A
4.9
(-2.1)
A
7
avr 19.2
(0.9)
18.9
(0.8)
27.3
(3)
4
(-3)
7.3
(-2.2)
8.3
(-1.9)
23
No Scale

Warning: fopen(./gnuplot/177674_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 12
1 2 3 4 range
A 7.7
(2.1)
A
6.6
(-3)
A
7
(-1.2)
A
7.9
(3)
A
1
B 9
(-0.1)
A
14.4
(3)
A
3.8
(-3)
A
11.3
(1.2)
A
11
C 12.7
(2.4)
A
2.4
(-3)
A
3.8
(-2.3)
A
13.8
(3)
A
11
avr 9.8
(1.8)
7.8
(-0.1)
4.9
(-3)
11
(3)
6

Warning: fopen(./gnuplot/177674_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177674_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 11
1 2 3 4 5 6 range
A 9.1
(2.3)
A
10.2
(3)
A
4.9
(-0.3)
A
1.2
(-2.7)
A
1.9
(-2.2)
A
0.7
(-3)
A
10
B 0.5
(-3)
A
6.8
(0.3)
A
11.8
(3)
A
0.8
(-2.8)
A
4.7
(-0.8)
A
6.2
(0)
A
11
C 2.5
(2.3)
A
2.2
(1.3)
A
2.7
(3)
A
0.9
(-3)
A
1.3
(-1.7)
A
1.6
(-0.7)
A
2
avr 4
(0.3)
6.4
(2.9)
6.5
(3)
1
(-3)
2.6
(-1.3)
2.8
(-1)
6
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177674_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.3456
Sequence Type Exemplar sequence
Representative Public ID W05H5.4 NCBI
Target Description W05H5.4 /REP_DB=WormBase Gene ID /WP=CE25140 /TR=P91841 /GB=CAB03479.2 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064246(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_064246 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-27) (srh-27) mRNA, complete cds. 11/11 None
GENEFINDER00000019751 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:12445235:12451310:1 11/11 None
W05H5.4 ENSEMBL cdna:known chromosome:CEL140:II:12448444:12449790:1 gene:W05H5.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000019746 2/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:12448440-12449787(+) 99.91 100.0
Public Domain and Genome References
Gene Title
Gene Symbol srh-27
Ensembl W05H5.4
Entrez Gene 189224 Entrez gene
SwissProt P91841 EMBL-EBI
WormBase CE25140 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03479 Hypothetical protein W05H5.4 [Caenorhabditis elegans] ref|NP_496647.1| Serpentine Receptor, class H family member (srh-27) [Caenorhabditis elegans] 0.0
blast CAB03482 Hypothetical protein W05H5.3 [Caenorhabditis elegans] ref|NP_496646.1| W05H5.3 [Caenorhabditis elegans] 0.0
blast CAE73510 Hypothetical protein CBG20968 [Caenorhabditis briggsae] 0.0
blast CAH60791 Hypothetical protein W05H5.8 [Caenorhabditis elegans] ref|NP_001022395.1| Serpentine Receptor, class E (epsilon) family member (sre-34) [Caenorhabditis elegans] 1.0E-167
blast CAE62121 Hypothetical protein CBG06161 [Caenorhabditis briggsae] 1.0E-113
blast CAC42339 Hypothetical protein T12A7.7 [Caenorhabditis elegans] ref|NP_502227.1| T12A7.7 [Caenorhabditis elegans] 6.0E-99
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.4E-67
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.5E-57
Pfam IPR001204 EMBL-EBI Phosphate transporter 1.0E-126
Pfam IPR004151 EMBL-EBI C. elegans Sre G protein-coupled chemoreceptor 1.9E-114
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_496647.1 7 30-49,69-91,106-128,148-170,214-236,257-279,289-311
W05H5.4 7 30-49,69-91,106-128,148-170,214-236,257-279,289-311
GENEFINDER00000019751 21 39-58,65-87,118-140,145-167,177-199,211-230,245-267,321-339,371-393,503-525,535-557,577-599,643-665,686-708,718-740,789-811,864-886,899-921,931-950,985-1007,1022-1041
Sequence
Target Sequence
>C. ELEGANS:177674_AT
gtacatgtgcattgggcttacttgatgaagatcagttaaccgcaaaaaatcgggtttacg
agaaattccctataccaaatccgaacctttgggatgaaaattatgtaaccactgacattg
agagctacaaattcaaaacatatgttattatatcggtgttggaaatttttatactgtgtg
tacatattattgtgataccaattgttggattccattttctatcaaagaatcagacagaga
aatcggagaagttggcagaagctcacaggaagactatgcagatgttggtttttcagctaa
ccgttcactgcatattccatcttgtgccatttgtctgtttcacttgggcaaccattttta
aacaaggaaatattggccttctgtcaggtggaatgttcacgtgggctctgcacggagccg
cgtgcaccttgacgcttctcttggcaaataagccatttcgaatgacaacgttgagccatt
tgaaatatgttttttgctgtggatgctgcaatggatcgacagctggaatctc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTACATGTGCATTGGGCTTACTTGA 252 459 497 Antisense
GAGAAATTCCCTATACCAAATCCGA 537 385 556 Antisense
GTTGGCAGAAGCTCACAGGAAGACT 710 435 747 Antisense
GTTTTTCAGCTAACCGTTCACTGCA 476 449 784 Antisense
GTTCACTGCATATTCCATCTTGTGC 425 445 799 Antisense
ATCTTGTGCCATTTGTCTGTTTCAC 460 31 815 Antisense
GTCTGTTTCACTTGGGCAACCATTT 2 473 829 Antisense
ATATTGGCCTTCTGTCAGGTGGAAT 209 19 866 Antisense
AGGTGGAATGTTCACGTGGGCTCTG 428 57 882 Antisense
CCTTGACGCTTCTCTTGGCAAATAA 218 269 923 Antisense
GCAATGGATCGACAGCTGGAATCTC 665 321 1004 Antisense
Sequence Source Affymetrix Proprietary Database