[Home] | [Total List]

[177611_at]

Description C41G6.9 /REP_DB=WormBase Gene ID /WP=CE15706 /TR=O17662 /GB=CAB02834.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 10      4grp_total > 03      6grp_cgc > 54      6grp_total_sub > Hat      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/177611_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 172
1 2 3 4 range
A 30.9
(-2.5)
A
30.7
(-2.6)
A
19.7
(-3)
A
168.8
(3)
P
149
B 29.3
(-3)
A
38
(-2)
A
29.1
(-3)
A
82.8
(3)
P
54
C 46.6
(-1.6)
A
6.6
(-3)
A
30.4
(-2.2)
A
178.3
(3)
P
172
avr 35.6
(-2.5)
25.1
(-3)
26.4
(-2.9)
143.3
(3)
118

Warning: fopen(./gnuplot/177611_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 98
1 2 3 4 5 6 range
A 12.9
(-3)
A
52.9
(0.7)
A
77.1
(3)
P
15.2
(-2.8)
A
31.4
(-1.3)
A
35.9
(-0.9)
A
64
B 21.6
(-3)
A
58.1
(3)
P
41.5
(0.3)
A
33.8
(-1)
A
54.5
(2.4)
P
45.2
(0.9)
P
37
C 25.1
(-2.7)
A
110.6
(3)
P
41.4
(-1.6)
A
38
(-1.8)
M
20.6
(-3)
A
26.3
(-2.6)
P
90
avr 19.9
(-3)
73.9
(3)
53.3
(0.7)
29
(-2)
35.5
(-1.3)
35.8
(-1.2)
54
No Scale

Warning: fopen(./gnuplot/177611_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 28
1 2 3 4 range
A 11.3
(-1.1)
A
6.7
(-2.5)
A
5.1
(-3)
A
24.7
(3)
P
20
B 9.3
(-1.6)
A
9.4
(-1.5)
A
6.7
(-3)
A
17.6
(3)
P
11
C 15.4
(-0.1)
A
1.9
(-3)
A
10.6
(-1.1)
A
30.1
(3)
P
28
avr 12
(-1)
6
(-3)
7.5
(-2.5)
24.1
(3)
18

Warning: fopen(./gnuplot/177611_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177611_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 31
1 2 3 4 5 6 range
A 2.4
(-3)
A
18.8
(3)
A
16.8
(2.3)
P
3.8
(-2.5)
A
9.5
(-0.4)
A
8.7
(-0.7)
A
16
B 7.5
(-3)
A
19.3
(1.8)
P
10.1
(-1.9)
A
9
(-2.4)
A
22.1
(3)
P
16.9
(0.9)
P
15
C 9.3
(-2.4)
A
33.7
(3)
P
10.5
(-2.2)
A
7.6
(-2.8)
M
6.7
(-3)
A
8.8
(-2.5)
P
27
avr 6.4
(-3)
23.9
(3)
12.5
(-0.9)
6.8
(-2.9)
12.8
(-0.8)
11.5
(-1.3)
18
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177611_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12985
Sequence Type Exemplar sequence
Representative Public ID C41G6.9 NCBI
Target Description C41G6.9 /REP_DB=WormBase Gene ID /WP=CE15706 /TR=O17662 /GB=CAB02834.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074360(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074360 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-165) (srh-165) mRNA, complete cds. 11/11 None
C41G6.9 ENSEMBL cdna:known chromosome:CEL140:V:15222532:15223963:1 gene:C41G6.9 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000010436 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:15222531-15223963(+) 99.44 100.0
Public Domain and Genome References
Gene Title
Gene Symbol srh-165
Ensembl C41G6.9
Entrez Gene 183385 Entrez gene
SwissProt O17662 EMBL-EBI
WormBase CE15706 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB02834 Hypothetical protein C41G6.9 [Caenorhabditis elegans] ref|NP_506761.1| Serpentine Receptor, class H family member (srh-165) [Caenorhabditis elegans] 1.0E-168
blast CAA98445 Hypothetical protein D1054.12 [Caenorhabditis elegans] ref|NP_505760.2| Serpentine Receptor, class H family member (srh-184) [Caenorhabditis elegans] 1.0E-64
blast CAB60391 Hypothetical protein Y60A3A.3 [Caenorhabditis elegans] ref|NP_507867.1| Serpentine Receptor, class H family member (srh-183) [Caenorhabditis elegans] 3.0E-61
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 4.5E-60
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 6.2E-40
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 2.8E-16
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_506761.1 6 24-46,59-81,101-123,136-153,192-214,235-257
C41G6.9 6 24-46,59-81,101-123,136-153,192-214,235-257
Sequence
Target Sequence
>C. ELEGANS:177611_AT
tgggagttccaacagtcgttacgacatttctttgttactcttttgtgggaggtcaactcg
tttcagtactcggagcaacaattgcttgggaacaaccaagaagttggcagcgcaaagtct
atgcaatctcgaattatattttatgctcattgttcatggttccagcatacttggatattc
cggatcaagatcttgggaaggaaattattaaaattacaatcctatgtgttcctgttgaaa
ttattaacgatcctgaatacttcatcctttcaaacaattcaacagcttgtttttgtttga
tttttgtactatcatttctcctaccacagaatttatttttcgtgagctcaatatccagga
acttgttccgtatggctgcaaaatccgcgaccacaatccgcatgcagaaaaaattttttg
ttgctctttcggcaactcatttggctgtatcgacattggcctttcatggactcctgtcaa
cgtttacaatgatcatggtgcatccaccatatcgtcgagcatc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGGGAGTTCCAACAGTCGTTACGAC 63 529 302 Antisense
GTTACGACATTTCTTTGTTACTCTT 47 441 319 Antisense
GGAGGTCAACTCGTTTCAGTACTCG 633 515 349 Antisense
TATGCTCATTGTTCATGGTTCCAGC 613 657 443 Antisense
GATCCTGAATACTTCATCCTTTCAA 111 417 550 Antisense
ACTATCATTTCTCCTACCACAGAAT 515 101 609 Antisense
GAACTTGTTCCGTATGGCTGCAAAA 616 349 660 Antisense
TGCTCTTTCGGCAACTCATTTGGCT 449 579 723 Antisense
TGGCTGTATCGACATTGGCCTTTCA 335 545 743 Antisense
CCTTTCATGGACTCCTGTCAACGTT 392 241 761 Antisense
TGCATCCACCATATCGTCGAGCATC 106 579 800 Antisense
Sequence Source Affymetrix Proprietary Database